(en)There is provided a method of identifying DNA responsible for conferring a particular phenotype in a cell which method comprises a) constructing a cDNA or genomic library of the DNA of said cell in a suitable vector in an orientation relative to a promoter(s) capable of initiating transcription of said cDNA or DNA to double stranded (ds) RNA upon binding of an appropriate transcription factor to said promoter(s), b) introducing said library into one or more of said cells comprising said transcription factor, and c) identifying and isolating a particular phenotype of said cell comprising said library and identifying the DNA or cDNA fragment from said library responsible for conferring said phenotype. Using this technique it is also possible to assign function to a known DNA sequence by a) identifying a homologue(s) of said DNA sequence in a cell, b) isolating the relevant DNA homologue(s) or a fragment thereof from said cell, c) cloning said homologue or fragment thereof into an appropriate vector in an orientation relative to a suitable promoter(s) capable of initiating transcription of dsRNA from said DNA homologue or fragment upon binding of an appropriate transcription factor to said promoter(s) and d) introducing said vector into said cell from step a) comprising said transcription factor.

1.ApplicationNumber: US-73888603-A
1.PublishNumber: US-2004133943-A1
2.Date Publish: 20040708
3.Inventor: PLAETINCK GEERT
PLATTEEUW CHRIST
MORTIER KATHARINE
BOGAERT THIERRY

4.Inventor Harmonized: PLAETINCK GEERT(BE)
PLATTEEUW CHRIST(BE)
MORTIER KATHARINE(BE)
BOGAERT THIERRY(BE)

5.Country: US
6.Claims:
(en)There is provided a method of identifying DNA responsible for conferring a particular phenotype in a cell which method comprises a) constructing a cDNA or genomic library of the DNA of said cell in a suitable vector in an orientation relative to a promoter(s) capable of initiating transcription of said cDNA or DNA to double stranded (ds) RNA upon binding of an appropriate transcription factor to said promoter(s), b) introducing said library into one or more of said cells comprising said transcription factor, and c) identifying and isolating a particular phenotype of said cell comprising said library and identifying the DNA or cDNA fragment from said library responsible for conferring said phenotype. Using this technique it is also possible to assign function to a known DNA sequence by a) identifying a homologue(s) of said DNA sequence in a cell, b) isolating the relevant DNA homologue(s) or a fragment thereof from said cell, c) cloning said homologue or fragment thereof into an appropriate vector in an orientation relative to a suitable promoter(s) capable of initiating transcription of dsRNA from said DNA homologue or fragment upon binding of an appropriate transcription factor to said promoter(s) and d) introducing said vector into said cell from step a) comprising said transcription factor.

7.Description:
(en)RELATED APPLICATIONS
[0001] This application is a divisional of U.S. patent application Ser. No. 10/057,108, entitled CHARACTERISATION OF GENE FUNCTION USING DOUBLE STRANDED RNA INHIBITION, filed Jan. 25, 2002, now pending; which is a divisional of U.S. patent application Ser. No. 09/347,311, entitled CHARACTERISATION OF GENE FUNCTION USING DOUBLE STRANDED RNA INHIBITION, filed Jul. 2, 1999, and now pending, which is herein incorporated by reference in its entirety.



SUMMARY OF THE INVENTION
[0002] The present invention is concerned with characterization or identification of gene function using double stranded RNA inhibition (dsRNAi) and methods of identifying DNA responsible for inducing a specific phenotype in a cell and a method of assigning function to known gene sequences.
[0003] It has recently been described in Nature Vol 391, pp.806-811, February 1998, that introducing double stranded RNA into a cell results in potent and specific interference with expression of endogenous genes in the cell and which interference is substantially more effective than providing either RNA strand individually as proposed in antisense technology. This specific reduction of the activity of the gene was also found to occur in the nematode worm Caenorhabditis elegans ( C. elegans ) when the RNA was introduced into the genome or body cavity of the worm.
[0004] The present inventors have utilized this technique and applied it further to devise novel and inventive methods of assigning functions to genes or DNA fragments, which have been sequenced in various projects, such as, for example, the human genome project and which have yet to be accorded a particular function and for use in identifying DNA responsible for conferring a particular phenotype.
[0005] Therefore, according to a first aspect of the present invention there is provided a method of identifying DNA responsible for conferring a phenotype in a cell which method comprises a) constructing a cDNA or genomic library of the DNA of said cell in an orientation relative to a promoter(s) capable of promoting transcription of said cDNA or DNA to double stranded (ds) RNA upon binding of an appropriate transcription factor to said promoter(s), b) introducing said library into one or more of said cells comprising said transcription factor, and c) identifying and isolating a desired phenotype of said cell comprising said library and identifying the DNA or cDNA fragment from said library responsible for conferring said phenotype.
[0006] In a preferred embodiment of the invention the library may be organised into hierarchical pools as described in more detail in the examples provided, prior to step b) such as to include, for example, gene families.
[0007] According to a further aspect of the invention there is also provided a method of assigning function to a known DNA sequence which method comprises a) identifying a homologue(s) of said DNA in a cell, b) isolating the relevant DNA homologue(s) or a fragment thereof from said cell, c) cloning said homologue or fragment into an appropriate vector in an orientation relative to a promoter(s) capable of promoting transcription of dsRNA upon binding of an appropriate transcription factor to said promoters, d) introducing said vector into said cell from step a) comprising said transcription factor, and e) identifying the phenotype of said cell compared to wild type.
[0008] In each aspect of the invention, the nucleotide or DNA sequence may either be provided in a sense and an antisense orientation relative to a single promoter which has the properties defined above, or alternatively it may be provided between two identical promoters. In both embodiments dsRNA is provided from the transcription initiated from the promoter following binding of its appropriate transcription factor.
[0009] The cell according to the invention may be derived from or contained in an organism. Where the cell is contained within an organism, the organism may be adapted to express the appropriate transcription factor. The organism may be any of a plant, animal, fungus or yeast but preferably may be the nematode worm C. elegans , which may be any of a wild type, a nuc-1 or pha-ts mutant of C. elegans or a combination of said mutations. In an alternative embodiment the DNA or cDNA library or the DNA homologue or fragment thereof may, advantageously, be transfected or transformed into a microorganism, such as a bacterial or yeast cell, which may be fed to the organism, which is preferably the nematode worm C. elegans . In this embodiment of the invention the microorganism may be adapted to express the appropriate transcription factor. Preferably, the microorganism is E. coli.
[0010] In each aspect of the invention, the DNA library, DNA homologue or DNA fragment may be constructed in a suitable DNA vector which comprises a sequence of nucleotides which encode said transcription factor. Alternatively, said transcription factor is encoded by a further vector. In an even further alternative, the cell or organism may express or be adapted to express said transcription factor. Preferably, any of the vectors used in the method according to the invention comprises a selectable marker which may be, for example, a nucleotide sequence encoding sup-35 or a fragment thereof. The nucleotide sequence may be orientated relative to a promoter such that binding of a transcription factor to the promoter initiates transcription of the DNA into double stranded RNA. FIG. 10 illustrates the vectors and the orientation of the DNA sequence which enable double stranded RNA production in C. elegans . Thus in one embodiment the DNA is located between two promoters on a vector capable of expressing dsRNA upon binding of an appropriate transcription factor to said promoters. Alternatively, the vector comprises two copies of the DNA sequence organised in a sense and antisense orientation relative to the promoter and which marker is selectable when contained in a pha-1 mutant C. elegans . Preferably, the promoters are any of T7, T3 or SP6 promoters and the transcription factor comprises the appropriate polymerase.
[0011] Preferably, the selectable marker comprises a nucleotide sequence capable of inhibiting or preventing expression of a gene in said cell and which gene is responsible for conferring a known phenotype. This nucleotide sequence may be part of or identical to said gene conferring said phenotype, and which nucleotide sequence is itself oriented relative to a suitable promoter(s) capable of initiating transcription of double stranded RNA upon binding of an appropriate transcription factor to said promoter(s). Alternatively, the nucleotide sequence may be a part of or identical to said gene sequence conferring said phenotype, and which nucleotide sequence is such as to permit integration of said suitable or further vector by homologous recombination in the genome of said cell and following said integration said nucleotide sequence is capable of inhibiting expression of said gene sequence conferring said phenotype. In this embodiment said nucleotide sequence comprises stop codons sufficient to prevent translation of said nucleotide sequence following its integration into said genome.
[0012] Compounds can, advantageously, in said method be added to said cell or organism for the purposes of screening for desired phenotypes, such as for example, resistance or sensitivity to the compound when compared to wild type. The promoters are preferably inducible. The transcription factor may in some embodiments be phage derived, such as for example, a T7 polymerase driven by a phage promoter. However, when C. elegans is utilised a worm specific or tissue specific promoter can be used, such as for example, let858, SERCA, UL6, myo-2 or myo-3. Preferably, the E. coli strain is an RNAaseIII and even more preferably an Rnase negative strain.
[0013] A further aspect of the present invention provides a method of generating a transgenic non-human organism comprising an exogenous transcription factor and a transgene comprising a promoter operably linked to DNA fragment which is expressed upon binding of said transcription factor thereto, the method comprising a) providing a first transgenic organism comprising a first construct incorporating DNA encoding an exogenous transcription factor and a second transgenic organism comprising a second construct including at least one promoter operably linked to a desired DNA sequence which is expressed upon binding of the transcription factor of said first transgenic organism thereto b) crossing said first and second transgenic organisms and selecting offspring expressing said desired DNA sequence. In one embodiment said first and second transgenic organisms are generated by transforming said first and second constructs into respective microorganisms for subsequent feeding to the respective organism. Preferably, said second construct comprises said desired DNA sequence in an orientation relative to said promoter so as to be capable of initiating transcription of said DNA to dsRNA upon binding of said transcription factor thereto. In this embodiment said second construct comprises two promoters flanking said desired DNA sequence which promoters can initiate transcription of said DNA sequence to dsRNA upon binding of said transcription factor to said promoters. Alternatively, said DNA sequence is provided in a sense and an antisense orientation relative to said promoter so as to produce dsRNA upon binding of the transcription factor to the promoters. In each of these embodiments the first and/or second constructs may preferably be provided with a reporter gene operably linked to a promoter which is capable of initiating transcription of said reporter upon binding of said transcription factor thereto. Preferably, the reporter gene encodes any of Luciferase, Green Fluorescent protein, β galactosidase or β-lactamase.
[0014] The present invention also includes a method of validating clones identified in yeast two hybrid vector experiments which experiments are well known to those skilled in the art and which experiments were first proposed by Chien et al. (1991) to detect protein-protein interactions. The method according to the invention comprises providing a construct including the DNA encoding a protein identified in a two hybrid vector experiment, which construct is such that said DNA is provided in an orientation relative to one or more promoters capable of promoting transcription of said DNA to double stranded RNA upon binding of an appropriate transcription factor to said promoters, transforming a cell, such as a bacterial cell or alternatively transforming an organism comprising said transcription factor with said constructs and identifying a phenotypic change in said cell or organism, which may be C. elegans or the like, compared to wild type. Preferably, the transcription factor is inducible in the cell or organism. Once again the DNA sequence may be located between two promoters or in both a sense and antisense orientation relative to a single promoter, as described above. Preferably, the promoter is a phage polymerase promoter and said transcription factor is a RNA polymerase, and preferably T7 polymerases. Also encompassed with the scope of the present invention are vectors used to transform said cells or organisms and the cells or organisms themselves.
[0015] In a further aspect of the present invention there is provided a method of alleviating pest infestation of plants, which method comprises a) identifying a DNA sequence from said pest which is critical either for its survival, growth, proliferation or reproduction, b) cloning said sequence from step a) or a fragment thereof in a suitable vector relative to one or more promoters capable of transcribing said sequence to RNA or dsRNA upon binding of an appropriate transcription factor to said promoters, and c) introducing said vector into the plant.
[0016] Thus, advantageously, the method according to the invention provides a particularly selective mechanism for alleviating pest infestation, and in some cases parasitic infestation of plants, such that when the pest feeds on the plant it will digest the expressed dsRNA in the plant thus inhibiting the expression of the DNA within the pest which is critical for its growth, survival, proliferation or reproduction. In a preferred embodiment, the pest may be any of Tylenchulus ssp. Radopholus ssp., Rhadinaphelenchus ssp., Heterodera ssp., Rotylenchulus ssp., Pratylenchus ssp., Belonolaimus ssp., Canjanus ssp., Meloidogyne ssp., Globodera ssp., Nacobbus ssp., Ditylenchus ssp., Aphelenchoides ssp., Hirschmenniella ssp., Anguina ssp., Hoplolaimus ssp., Heliotylenchus ssp., Criconemellassp., Xiphinemassp., Longidorus ssp., Trichodorus ssp., Paratrichodorus ssp., Aphelenchs ssp. The DNA sequence or fragment thereof according to this aspect of the invention may be cloned between two tissue specific promoters, such as two root specific promoters.
[0017] A further aspect of the invention concerns the vector used in each of the methods of the invention for constructing said library, which vector comprises two identical promoters oriented such that they are capable of initiating transcription of DNA sequence located between said promoters to dsRNA upon binding of an appropriate transcription factor to said promoters. The DNA sequence may, for example, include a multiple cloning site. Preferably, the expression vector comprises a nucleotide sequence encoding a selectable marker. In one embodiment the nucleotide sequence encoding said selectable marker is located between two identical promoters oriented such that they are capable of initiating transcription of DNA located between said promoters to double stranded RNA upon binding of an appropriate transcription factor to said promoters. Preferably, the selectable marker comprises a nucleotide sequence encoding sup-35, for introduction into C. elegans having a pha-1 mutation.
[0018] Preferably, the transcription factor comprises either a phage polymerase which binds to its corresponding promoter or a C. elegans specific promoter and even more preferably T7 polymerase. Preferably, the vector includes a multiple cloning site between said identical promoters.
[0019] In a further aspect of the invention there is provided an expression vector for expressing an appropriate transcription factor for use in a method according to the invention which vector comprises a sequence of nucleotides encoding said transcription factor operably linked to suitable expression control sequences. Preferably, the expression control sequences include promoters which are inducible, constitutive, general or tissue specific promoters, or combinations thereof. Preferably, the transcription factor comprises a phage polymerase, and preferably T7, T3 or SP6, RNA polymerase.
[0020] A further aspect of the invention provides a selection system for identifying transformation of a cell or organism with a vector according to the invention which system comprises a vector according to the invention wherein said selectable marker comprises a nucleotide sequence capable of inhibiting or preventing expression of a gene in said cell or organism which gene is responsible for conferring a known phenotype. Preferably said nucleotide sequence corresponds to a part of or is identical to said gene conferring said known phenotype, and which nucleotide sequence is itself located between two identical promoters capable of initiating transcription of double stranded RNA upon binding of an appropriate transcription factor thereto. Alternatively, the nucleotide sequence comprises a nucleotide sequence which is a part of or identical to said gene sequence which confers a known phenotype on said cell or organism, and which is such that following integration of said vector by homologous recombination in the chromosome of said cell or organism said sequence inhibits expression of said gene sequence conferring said known phenotype. Preferably, according to this embodiment the nucleotide sequence comprises stop codons sufficient to prevent translation of the-nucleotide sequence following integration into said chromosome. Preferably, the known gene sequence comprises a sup-35 gene or a fragment thereof which is selectable by identifying offspring growing at a temperature above 25° C. following introduction in a pha-1 et123ts mutant C. elegans worm.
[0021] In a further aspect of the invention provides said known gene sequence comprises a sup-35 gene or a fragment thereof which is selectable by identifying offspring growing at a temperature above 25° C. following introduction of said vector in a pha-1 et123ts mutant C. elegans worm. An even further aspect comprises a method of assigning function to a DNA sequence of a multicellular organism which method comprises a) providing i) a construct comprising said DNA fragment cloned between two promoters capable of promoting transcription in said multicellular organism, in a multicellular organism capable of initiating transcription from said promoter; b) identifying the phenotype of said multicellular organism compared to wild type.



BRIEF DESCRIPTION OF THE DRAWINGS
[0022] The present invention may be more clearly understood by the following examples which are purely exemplary with reference to the accompanying figures, wherein:
[0023]FIG. 1 is a nucleotide sequence of plasmid pGN1 in accordance with the present invention.
[0024]FIG. 2 is a nucleotide sequence of plasmid pGN100 in accordance with the present invention.
[0025]FIG. 3 is a schematic representation of the vectors used and the transformation regime used in the methods according to the present invention.
[0026]FIG. 4 is an illustration of an expression vector used in accordance with the invention.
[0027]FIG. 5 is a schematic illustration of the T7 RNA polymerase expression vectors used for transforming C. elegans.
[0028]FIG. 6 is an illustration of plasmid pGN1.
[0029]FIG. 7 is a diagrammatic representation of an enhanced vector for dsRNA inhibition encoding sup-35 dsRNA.
[0030]FIG. 8 is an illustration of a vector for integration into the genome of C. elegans.
[0031]FIG. 9 is an illustration of the position of a DNA sequence(s) relative to a suitable promoter to initiate expression of dsRNA from the DNA sequence(s).
[0032]FIG. 10 is a representation of plasmid pGN108.
[0033]FIG. 11 is a representation of plasmid pGN105.
[0034]FIG. 12 is a representation of plasmid pGN400.
[0035]FIG. 13 is a representation of plasmid pGN401.
[0036]FIG. 14 is a representation of plasmid pGN110.
[0037]FIG. 15 is a representation of plasmid pAS2 with forward and reverse T7/T3/SP6 promoters.
[0038]FIG. 16 is a representation of plasmid pGAD424 with forward and reverse T7/T3/SP6 promoters.
[0039]FIG. 17 is a representation of plasmid pAS2-cyh2-HA+, both T7-final.
[0040]FIG. 18 is a representation of plasmid pGAD424-without-FULL-ICE-BOT-H-T7.
[0041]FIG. 19( a ) is a representation of plasmid pGN205 and ( b ) is a representation of plasmid pGN207.


EXAMPLE A
Construction of an Ordered and Hierarchical Pooled cDNA Library and Applications Thereof
[0042] A Random Ordered and Pooled Library:
[0043] The vector is an E. coli vector harboring two T7 promoters, with a multiple cloning site (MCS) in between. The two promoters are orientated towards each other, and towards the MCS. In the presence of T7 RNA polymerase, expressed in E. coli, C. elegans or any other organism, RNA will be produced, starting from the two T7 promoters. As these are oriented in the opposite sense, both strands of RNA will be produced from the DNA inserted (cloned) into the MCS in between the two promoters which results in the generation of double stranded RNA (dsRNA) upon binding of the T7 RNA polymerase thereto.
[0044] A C. elegans cDNA library is constructed in the MCS using standard molecular biological techniques. The library is transformed into E. coli and the resulting E. coli are grown in culture and stored in 96 multi-well plates. At this stage, plasmid DNA can be isolated and stored in 96-multi-well plates corresponding to those of the E. coli colonies. Approximately 100,000 colonies are scored. In this way, the library will harbor approximately 5 times the total expressed cDNA variation of C. elegans , which gives the opportunity for low expressed sequences to be present in the library. This will result in approximately 1041 96-well plates. The plates are hierarchical pooled as necessary. For the present pooling of the clones is arranged in a range of 10 to 100. If the hierarchical pooling is per 8 or 12 (numbers are more convenient: as 96-well plates have a 8 to 12 grid), this will result in approximately 87 multi-well plates and approximately 8352 wells. If hierarchical pooling is per 96 wells, which is a full plate, this results in approximately 11 plates and approximately 1041 wells. At any stage of the hierarchical pooling, plasmid DNA can be isolated, which would be less elaborate as less plates are used, but will result in a loss of complexity although this should not be the case in the pooling per 12. The pooling of the DNA can also be carried out with the original DNA.
[0045] The experiments below describe how the hierarchical pooling should be performed, both for the DNA and for the E. coli library.
[0046] An Ordered Library for RNAi Technology, Harboring Every Gene of the C. elegans Genome, with Applications Thereof
[0047] As the genome-sequencing project is coming to an end, this information can be used in the application of T7 RNA inhibition technology. Every gene of the C. elegans genome can be cloned using PCR technology. In preference, exons will be cloned with a minimal length of 500 bp. If the exons are too small, smaller fragments will be isolated with PCR, or even parts of introns and neighboring exons will be isolated with PCR technology so that at least a sufficient part of the translated region of the gene is cloned. For this, at least 17000 PCR reactions need to be performed. This collection of PCR products will be cloned in a T7 vector as described (two T7 promoters oriented towards each other with a multiple cloning site in between). Every PCR product is cloned independently, or can be used to generate a random library, analogous to the described cDNA library. If every PCR product is cloned individually, the resulting bacteria and plasmid DNA can be pooled in various ways. Firstly, this collection of individually cloned PCR products in the T7 RNAi vector can be pooled randomly, as described in the random library. This pooling can also be done in a more rational way. For instance, the genes of the C. elegans genome can be analyzed using bioinformatic tools (in silico biology). Various genes of the genome will belong to a gene family, or will have homologues in the genome. These members of the gene family will be pooled, or the members, being homologues will be pooled. In this way the total number of about 17000 clones is reduced to a more useable quantity. This library can be used to screen for phenotypes in the methods according to the invention. The resulting phenotype gives a functional description to the gene or gene family or gene homologues of the C. elegans genome. As the library consists of a part of every gene in the genome, this method enables description of the full genome in functional-phenotypic terms. For this the double stranded RNA (dsRNA) needs to be introduced in the worm. This introduction of clones alone, or pooled clones, being random pooling or rational pooling can be achieved in several ways as described.
[0048] Example of a Vector for the Expression of Double Stranded RNAi
[0049] Any vector containing a T7 promoter may be used, and which contains a multiple cloning site (there are many commercially available). Primers containing the T7 promoter and a primer with the reverse complementary strand, both with the appropriate ends are designed. These primers can be hybridized, and if well designed, cloned in the vector of choice. The minimal sequence for a T7 promoter is TAATACGACTCACTATAGGGCGA (SEQ ID NO: 12). Although any vector can be used for the construction of a T7 expression vector there follows an example of how to achieve this with the vector pGEM-3zf(−).
[0050] Vector pGEM-3zf(+) (PROMEGA) was digested with HindIII and SalI
[0051] Primers oGN1 and oGN2 were mixed together at a final concentration of 1 μg/30 μl boiled and cooled slowly to room temperature.
[0052] The primer was ligated into the vector using standard ligation procedures. The resulting vector is pGN1 (shown in FIG. 1) and contains two T7 promoters oriented towards each other, and harbors a multiple cloning site in between.
[0053] Sequences of oGN1 (SEQ ID NO:13) and oGN2 (SEQ ID NO:14) are:
oGN1: AGC TGT AAT ACG ACT CAC TAT AGG GCG AGA AGC TT oGN2: TCG AAA GCT TCT CGC ATA ATA GTG AGT CGT ATT AC

[0054] Example of the Construction of a Library
[0055] RNA may be isolated from every organism that is sensitive to RNAi. In general the isolated RNA is then copied into double stranded cDNA, and subsequently prepared in suitable vectors for cloning. Several procedures exist and molecular biology kits can be purchased from various firms including Promega, Clontech, Boehringer Mannheim, BRL, etc which enable:
[0056] isolation of RNA,
[0057] eventually polyA RNA can be isolated (several techniques and kits available),
[0058] first strand synthesis with AMV reverse transcriptase, random hexameric primers and/or oligo (dT) primer,
[0059] second strand synthesis with Rnase H, DNA Polymerase I,
[0060] flush ends with T4 DNA Polymerase,
[0061] addition of an adaptor with T4 DNA ligase,
[0062] eventually treatment with T4 polynucleotide Kinase,
[0063] cloning of the cDNA into the vector.
[0064] The resulting ligation mixture can be considered as the cDNA library. The ligation contains all cDNA of the procedure ligated into the vector of interest. To order the library, the ligation needs to be transformed into E. coli strains.
[0065] Application of this E. coli or DNA Library
[0066] T7 RNA producing strain:
[0067] a standard strain is BL21 (DE3): F-ompT[lon]hsds(r- m-; and E. coli B strain) γ(DE3). Eventually variants-of PL21 (DE3) can be used, although BL21 (DE3)pLysS is used.
[0068] any other E. coli strain which produces the T7 RNA polymerase, which may be available needs to be constructed. This can be generated easily using a phage, which is commercially available, in this case, the γCE6 vector (provided by Promega) is used. Almost every E. coli strain can be transfected with this phage and will produce T7 RTA polymerase.
[0069] a RNAseIII mutant E. coli:
[0070] Various strains are in principle available, we chose in a first experiment to use strain AB301-105: ma-19, suc-11, bio-3, gdhA2, his95, rnc-105, relA1, spoT1, metB1. (Kinder et al. 1973 Mol. Gen. Genet 126:53), but other strains may suit better. This strain is infected with γCE6 and so a T7 producing variant will be constructed.
[0071] Wild type C. elegans worms can be grown on the bacteria pools. The bacteria is expressing the T7 RNA polymerase. This results in large quantities of dsRNA in the gut of the C. elegans , which will diffuse in the organism and results in the inhibition of expression. This library can now be used for the screening of several phenotypes. This technique has the advantage that it is a much faster to detect relevant genes in certain pathways, than the known C. elegans technology. Moreover, if an interesting phenotype is found, the responsible gene can be cloned easily.
[0072] Using the hierarchical pooling one can easily find in a second screen the relevant clone of the pool. The inserted DNA of this clone can then be sequenced. This experiment results in genetic and biochemical DATA in one step.
[0073] Wild type C. elegans strains can be combined with compounds to screen for phenotype, drug resistance and or drug sensibility. The C. elegans strain can be a mutant strain, screening for an enhanced phenotype, reduced phenotype, or a new phenotype. The C. elegans strain can be a mutant strain, and the library screen can be combined with compounds. So one can screen for drug resistance, drug sensibility, enhanced phenotype, reduced phenotype, or a new phenotype. The E. coli strain may be any T7 RNA polymerase expressing strain, like BL21 (DE3), for example, but the formation of double strand RNA may be enhanced by using a special E. coli strain that is RNAseIII negative. RNAseIII recognizes specific loops in dsRNA. Eventually, an E. coli strain can be used that is deleted in RNAses other than RNAseIII or an E. coli can be used that is deleted in one or more RNAses. The expression of the T7 RNA polymerase in most known E. coli strains and constructs which are available to generate T7 RNA polymerase producing E. coli strains, generally comprise an inducible promoter. In this way the production of the T7 RNA polymerase is regulated, and thus the production of the dsRNA. Advantageously, this feature can be used to “pulse” feed the C. elegans worms at specific stages of growth. The worms are grown on the non-induced E. coli strains. When the worm has reached the stage of interest, the T7 RNA production in the bacteria is induced. This allows the studying of the function of any gene at any point in the life cycle of the animal.
[0074] Screening the Library for Homologues of Putative Interesting Human Genes, and Assign Function to These Genes
[0075] Hundreds of genes have been isolated in various projects, being genomic projects, differential expressed arrays, hybridization studies, etc. The described cDNA library can provide a way to validate and or assign function to these genes in a fast and efficient manner. First of all the worm homologue or homologues or the genes need to be identified by bioinformatic tools (in silico biology). PCR primers are developed and the cDNA fragment is isolated using PCR technology. PCR can be performed on the hierarchical pools. The positive pool or individual wells harboring the bacteria that has the appropriate cDNA is fed to C. elegans and the phenotype is scored.
[0076] PCR can be performed on cDNA isolated from C. elegans . The resulting DNA can be cloned in the T7 vector and transformed in the dsRNA producing E. coli on which the C. elegans worms are then fed. Depending on which way is faster and more reliable a choice needs to be made.
[0077] If the gene belongs to a gene family, the worm may need to be fed on a mixture of bacteria, each of them harboring a part of the member of the gene family. E. coli strains, growth conditions, combinations with compounds can be performed as described above.
[0078] If the library rational is used, in which all the genes of C. elegans are cloned in a organized and structured way, the C. elegans homologue and eventually the other homologues, orthologues, and members of the gene family can be traced back easily in the library using in silico biology. No PCR is involved in this step, and the bacteria and or DNA can be isolated on which the worm will be grown.
EXAMPLES
[0079] The idea of the series of experiments was to test both the RNAi vector and the various E. coli strains that were constructed.
[0080] 1) Construction of a Test Plasmid
[0081] Any cDNA that gives a clear phenotype in the worm when knocked-out, or used in a RNAi experiment can be used. It is known that unc-22 is a good candidate, but many other genes are possible. We opted for a sensitive system that can be used at a later stage. The system was tested with sup-35 in a pha-1 background. Exon 5 of the sup-35 was isolated by PCR and cloned in the T7 promoter vector pGN1. The resulting vector was designated pGN2. pha-1 (e2123) mutant worms cannot produce offspring at temperatures higher than 25° C. This is due to a developmental problem in embryogenesis. When sup-35 is knocked-out, or inhibited in this strain, offspring may grow at this temperature. Combination of pha-1 mutant worms and sup-35 RNAi is a good system to validate the various options.
[0082] 2) Testing the RNAi Using an E. coli Strain that Produces dsRNA.
[0083] pGN2 was introduced in E. coli strain BL21(DE3) and T7 RNA polymerase was induced with IPTG. C. elegans worms (pha-1 (e2123)) were inoculated on this bacteria, and grown at the restricted temperature of 25° C. As this mutant is an embryonic mutant at this temperature, no offspring will be observed. If the sup-35 gene is efficiently inhibited by the dsRNA present in the E. coli , offspring will be observed.
[0084] pGN2 was introduced in E. coli strain AB301-105(DE3) and T7 RNA polymerase was induced with IPTG. C. elegans worms (pha-1 (e2123)) were inoculated on this bacteria, and grown at the restricted temperature of 25° C. As this mutant is an embryonic mutant at this temperature, no offspring will be observed. If the sup-35 gene is efficiently inhibited by the dsRNA present in the E. coli , offspring will be observed.
[0085] 3) Improving the Worm Strain for Better Uptake of dsRNA.
[0086] Before plating the pha-1 C. elegans on the E. coli strain that produce the double stranded sup-35 RNA. The worm was mutagenised with EMS (Methane sulfonic Acid Ethyl). The offspring of this mutagenised worm is then plated on the bacteria. The worm that feed on this bacteria give larger offspring which has a mutation that results in an improvement of dsRNA uptake, and can be used for further experiments.
[0087] Stable Integration of the dsRNA Producing Vector into the Genome of the T7 RNA Polymerase Producing Worm
[0088] An E. coli vector can be constructed harboring the following features; Two T7 promoters directed towards each other, with a restriction site or a multiple cloning site in between. Furthermore, the vector may contain the C. elegans sup35 genomic DNA, engineered in such a way that it contains several stopcodons at various intervals, so that no full length protein can be expressed form the sup35 genomic DNA fragment as illustrated in FIG. 8. Any cDNA or cDNA fragment can be cloned in the multiple cloning site between the two T7 promoters. When this vector is introduced in a C. elegans strain which expresses T7 RNA polymerase, the cDNA or DNA fragment cloned between the two T7 promoters will be transcribed, generating dsRNA from the cloned fragment.
[0089] The vector is designed to be used in pha-1 (e2123) mutant worms expressing T7 RNA polymerase. The expression of the T7 RNA polymerase may be constitutive or regulated, general or tissue specific. These pha-1 (e2123) worms cannot produce offspring at temperatures higher than 25° C., which is due to a development problem in embryogenesis. When sup-35 is inhibited or knocked-out in this stain, offspring may grow at this temperature.
[0090] When the vector is introduced in the worm, the vector may integrate by homologous recombination (Campbell-like integration). It has been shown that homologous recombination occurs in C. elegans , although at low frequencies (Plasterk and Groenen, EMBO J. 11:287-290, 1992). Homologous recombination at the sup-35 gene will result in a knock-out of the gene as the two resulting sup-35 genes will harbor the stopcodons. The resulting worm, and its offspring, if this recombination happens in the eggs, will have a copy of the vector integrated in the genome. This can be selected as only the worms for which the sup-35 has been knocked-out will have offspring at temperatures higher than 25° C. Furthermore, the resulting worm will stably produce double stranded RNA from the DNA fragment cloned between the two T7 promoters. This worm can now be considered as a stable transgenic worm strain with a reduction of function of the gene, from which a fragment has been cloned between the two T7 promoters.
[0091] The DNA may be delivered to the worm by several techniques, including injection, ballistic transformation, soaking in the DNA solution, feeding with bacteria. New and other methods that increase the transformation efficiencies can be considered.
[0092] The target C. elegans strain may in addition, have other mutations than the-pha-1 (e2123) mutation, and may express other genes than T7 RNA polymerase.
EXAMPLE B
A Yeast Two-hybrid-RNAi Vector
[0093] A yeast two hybrid vector can be constructed harboring the two T7 promoters. The vectors can be designed to replicate both in yeast and in E. coli . In general cDNA libraries for the yeast two hybrid system are made in the Gal4 or LexA vectors. The library is constructed in vectors having the activation domain of one of these genes. A vector can be constructed that can still perform in the yeast two hybrid screen but which also contains two T7 promoters orientated towards each other, with a cloning site therein between. The order of the sequences in the plasmid will then be “plasmid backbone, (GAL4-T7), MCS, T7, backbone”. A C. elegans cDNA library constructed in this vector can be used as a standard yeast two hybrid library in an experiment to isolate interacting proteins with a given protein. Once a clone is isolated, the plasmid can be introduced in an E. coli strain expressing the T7 RNA polymerase, and hence will produce dsRNA of the cloned fragment. The bacteria producing this dsRNA can be fed to the worm and phenotypes can be scored. As in the previous example, this validation procedure for a newly isolated yeast two hybrid clone is remarkably shorter than the standard procedure, which requires PCR and/or cloning steps, RNA experiments and/or knock-out experiments. In most cases isolated clones are sequenced first, and on the basis of the sequence, a decision is made to continue with further experiments. In the present invention every isolated clone can easily be introduced into the appropriate E. coli and fed to the worm. Validation is then performed by phenotype analysis.
[0094] To apply this procedure a yeast two hybrid was performed using a known gene as bait and the newly constructed library as the target. Proteins coded by the clones in the target that interact with the bait protein, will result in positive yeast clones expressing the reporter molecule such as can be observed by LacZ staining with X-gal. The plasmid coding for the target protein is isolated directly from the yeast strain and introduced in E. coli . The E. coli is T7 RNA polymerase producing E. coli . In this case, double stranded RNA is produced from the DNA cloned in the multiple cloning site of the vector. When this dsRNA is fed to the worm using the methods described previously, the gene has inhibited in the worm, resulting in a particular phenotype.
[0095] This yeast two hybrid vector can advantageously be used to construct an ordered and hierarchically pooled library as described in the previous example.
[0096] A yeast strain can also be constructed that conditionally produces T7 RNA polymerase. After yeast two hybrid experiments, the expression of the T7 polymerase could be induced, resulting in the production of dsRNA in the yeast cell. Consequently the yeast could be fed to the worm. Evidence is available showing that the C. elegans worms can feed on yeast.
[0097] Construction of a T7 RNA Polymerase Producing Strain, and Applications Thereof
[0098] A C. elegans strain can be constructed that expresses T7 RNA polymerase. The expression can be general and constitutive, but could also be regulated under a tissue specific promoter, an inducible promoter, or a temporal promoter or a promoter that harbors one of these characteristics or combination of characteristics. DNA can be introduced in this C. elegans strain. This is done either by injection, by shooting with particles, by electroporation or as aforementioned by feeding. If the DNA is a plasmid as described in the previous examples, i.e. a plasmid harboring a cloned cDNA fragment or a PCR fragment between two flanking T7 promoters, then dsRNA of this cDNA or PCR fragment is formed in the cell or whole organism resulting in down regulation of the corresponding gene. The introduced DNA can have an efficient transient down regulation. The introduced DNA can form an extrachromosomal array, which array might result in a more catalytic knock-out or reduction of function phenotype. The plasmid might also integrate into the genome of the organism, resulting in the same catalytic knock out or reduction of function phenotype, but which is stably transmittable.
[0099] Plasmid DNA harboring a cDNA or a part of a cDNA or an EST or an PCR fragment of C. elegans cloned between two T7 promoters as described in Examples A) and B) can be introduced in the T7 RNA polymerase worm, by standard techniques. Phenotypes can be analysed—DNA from an ordered and pooled library as in Example A) can be introduced in the T7 RNA polymerase worm, by standard techniques (injection, shooting). Phenotypes can be analysed. With the hierarchical pool, the original clone can be found easily.
[0100] The same procedure can be performed with a mutant worm expressing the T7 RNA polymerase. Screening for enhanced, reduced or new phenotypes.
[0101] The procedure can be used to enable screening of compounds. Screening with either a wild-type strain or a mutant strain for enhanced or new phenotypes.
[0102] The DNA could be introduced in the worm by new methods. One of which is the delivery of DNA by E. coli . In this case the hierarchical pooled library is fed to the animal. To prevent digestion of the E. coli DNA in the gut of the nematode, preferentially a DNAse deficient C. elegans will be used, such as nuc-1 (e1392). This procedure would be one of the most interesting as it would be independent of transformation efficiencies of other techniques, and generally faster and less labourious.
[0103] 2) Putative Enhancements of the Method.
[0104] A vector is designed, so that it harbors the sup-35 cDNA or a part of this cDNA, cloned in between two T7 promoters. The rest of the vector is as described in Examples A) and B). This vector can be introduced into a pha-its mutant C. elegans . A temperature selection system exists in this case and only those worms which have taken up the DNA and express the double stranded sup-35 RNA will survive at restricted temperatures. The hierarchical pooled library can be delivered by any method described above.
[0105] The vector can be used to construct a library that is introduced in a T7 RNA polymerase expressing E. coli . In this case we have an analogous screening as in part A) with an additional screening for worms where the dsRNA of sup-35 is active.
[0106] The DNA and or dsRNA of sup-35 could be delivered on a different plasmid. For the feeding, both DNA feeding (Example C) or dsRNA feeding Example A) and B), this means that the two plasmids could be present in one bacterium, or that the worm is fed on a mixture of bacteria, one of which harbors the sup-35 construct.
[0107] Example of the Construction of a T7 RNA Producing C. elegans
[0108] To produce T7 RNA polymerase in the worm, several possibilities are possible. The T7 polymerase can be expressed under various promoters, being inducible promoters, constitutive promoters, general promoters and tissue (cell) specific promoters, or combinations of those. Examples of these promoters are the heatshock promoter hsp-16, the gut promoter ges 1, the promoter from cet858, but also the promoter of dpy 7 and the promoter element GATA1. In this example the T7 RNA polymerase is expressed under the control of the hsp-16 promoter that is available in the pPD49.78 vector. The T7 RNA polymerase is isolated as a PCR product using the primers of GN3 and GN4.
[0109] The resulting PCR product is digested with NheI and NcoI, as is the vector in which we want to clone, being the Fire vector pPD49.78. The resulting vector is pGN100 illustrated in FIG. 2. oGN3 (SEQ ID NO: 15): CAT GGC AGG ATG AAC ACG ATT AAC ATC GC; oGN4 (SEQ ID NO:16): ATG GCC CCA TGG TTA CGG GAA CGC GAA GTC CG; pGN100 is included.
[0110] The vector is introduced into the worm using standard techniques, such as micro injection, for example.
[0111] The following strains were then constructed:
[0112] Wild-type (pGN100)
[0113] nuc-1 (el392) (pGN100)
[0114] pha-1 (e2123) (pGN100)
[0115] pha-1; nuc-1 (pGN100)
[0116] All of these strains are able to produce T7 RNA polymerase when temperature induced or alternatively by metals such as application of heavy cadmium or mercury. The procedure for temperature induction is to shift the animal to a temperature of 30-33° C. for at least one hour, then the animal can be shifted back to standard temperatures (15-25° C.).
[0117] The wild type strain producing T7 RNA polymerase can be used for the production of any RNA in the worm. More specifically, the plasmids from the described libraries can be introduced in these worms, and phenotypes can be scored.
[0118] The nuc-1 mutant worm will be used to introduce DNA via bacteria on which the worm feed. As the nuc-1 worm does not digest the DNA, the plasmid DNA can cross the gut wall. If taken up by the cells that produce the T7 RNA polymerase, dsRNA will be produced thus inhibiting the gene from which the RNA was transcribed.
[0119] The pha-1 mutant strain that produced T7 RNA polymerase can be used to enhance the procedures as described above. DNA can be introduced by shooting, micro injection or feeding. More specifically this strain can be used for the vectors that produce dsRNA from sup-35 and from the gene of interest, the latter can be a PCR product, a cDNA, or a library as described.
[0120] The pha-1; nuc-1 mutant producing T7 RNA polymerase can be used for the bacterial delivery of the DNA. DNA will preferentially be the plasmid that produce dsRNA from both sup-35 and the gene of interest. The worm strain will preferentially produce the T7 RNA polymerase in the gut. Delivery will preferentially happen by feeding the worm on bacteria harboring the plasmid.
[0121] Application of the RNAI Technology in Plants
[0122] Nematodes are responsible a large part of the damage inflicted on plants and more particularly to plants used in the agricultural industry. The RNAi procedures according to the invention can be applied to plants to prevent these parasitic nematodes from feeding longer. In a first step, a DNA fragment is isolated from the parasitic plant nematode that is critical for the animals survival or growth, or to feed or to proliferate. Any gene from which the expression is essential is suitable for this purpose.
[0123] A part of this gene, an exon or cDNA is cloned. This DNA fragment can be cloned under the influence of a tissue specific promoter preferably a root specific promoter even more preferably between two root specific promoters. The DNA of the cloned gene under the control of the root specific promoter can be introduced in the plant of interest, using plant transgenic technology. For every parasitic nematode, a different piece of DNA may be required and likewise for every plant race, a different promoter will be needed.
[0124] The root will produce RNA or dsRNA from the introduced piece of DNA when root specific promoter is utilised. As the nematode feeds on the plant, the RNA and/or dsRNA will be consumed or ingested by the nematode. The RNA and/or dsRNA can enter the cells of the nematode and perform its inhibitory action on the target DNA. Depending on the nature of the cloned DNA piece of worm, the nematode will not be able to survive, to eat, proliferate, etc in any case preventing the animal of feeding longer on the plant, and thus protecting the plant.
[0125] Construction of a T7 RNA-polymerase Producing C. elegans
[0126] To produce a T7 RNA polymerase or other RNA polymerases in animals, and more particularly in nematodes and most particularly in C. elegans , several possibilities can be envisaged. The T7 RNA polymerase can be expressed under various promoters. These promoters may be inducible promoters, constitutive promoters, general promoters, tissue specific promoters, or combinations of those.
Example 1
[0127] Construction of a Basic Vector for Expression of T7 Polymerase in C. elegans
[0128] The T7 polymerase coding sequence was PCR amplified from XCE6 (Novagen, Madison, Wis., USA) using the primers oGN26(ATGGAATTCTTACGCGAACGCGAAGTCCG; SEQ ID NO:17) and oGN46(CTCACCGGTAATGAACACGATTAACATCGC; SEQ ID NO:18), using standard procedures (PCR, A practical approach, 1993, Ed. J. McPherson, et al, IRL Press). The resulting DNA fragment encoding for the T7 RNA polymerase was digested with AgeI and EcoRI and inserted into the Fire vector pPD97.82 digested with AgeI and EcoRI. The resulting construct encodes for an open reading frame of T7 RNA polymerase in fusion with the SV40 large T antigen nuclear localization signal (NLS) with amino acid sequence MTAPKKKRKVPV (SEQ ID NO: 19). This nuclear localization signal sequence is required to translocate the T7 RNA polymerase from the cytoplasm to the nucleus, where it is able to bind to its specific promoters, designated T7 promoters. Upstream of the coding sequence for the T7 polymerase fusion protein is a minimal promoter (myo-2) preceded by a multiple cloning site (MCS) in-which several C. elegans promoters can be inserted. This plasmid (PGN 1 O 5 shown in FIG. 11) is a basic T7 RNA polymerase plasmid which enables the expression of T7 polymerase in C. elegans . Derivatives of this plasmid wherein promoters are cloned into the multiple cloning site, allow for the inducible, constitutive, general and tissue specific expression of T7 RNA polymerase in C. elegans , as expression will be regulated by the promoter cloned in the multiple cloning site.
[0129] Although not restricted to these examples, for the following promoters it is known that they induce expression in the following tissues: let-858 (ubiquitous expression), myo-2 (pharynx expression), myo-3 (body wall muscles), egl-15 (vulval muscles), unc-119 (pan-neuron).
Example 2
[0130] Construction of a Vector for Expression of T7 RNA Polymerase in C. elegans Muscle Tissue
[0131] The T7 RNA polymerase coding sequence was PCR amplified from X CE6 using the primers oGN43 (GCCACCGGTGCGAGCTCATGAACACGATTAACATCGC; SEQ ID NO:20) and oGN44 (CACTAGTGGGCCCTTACGCGAACGCGAAGTCCG; SEQ ID NO:21) digested with AgeI/SpeI and inserted in the pGK13 vector digested with AgeI/SpeI. (This vector contains the strong SERCA promoter which drives expression in the pharynx, the vulval muscle, the tail and the body wall muscle). A nuclear localization signal (NLS) of SV40 large T antigen was inserted in front of the T7 polymerase coding sequence by insertion of two overlapping oligo's oGN45 (CCGGATGACTGCTCCAAAGAAGAAGCGTAAGCT; SEQ ID NO:22) and oGN46 (CTCACCGGTAATGAACACGATTAACATCGC; SEQ ID NO:18) into the SacI/AgeI restriction sites. The resulting construct was called pGN 1 O 8 as shown in FIG. 10. Introduction of this plasmid into C. elegans results in the expression of T7 RNA polymerase in the pharynx, vulva muscle, tail and body wall muscles.
[0132] To test expression and functionality of T7 RNA polymerase in C. elegans under the regulation of the SERCA promoter, pGN108, which encodes the T7 RNA polymerase under the control of the SERCA promoter was injected into C. elegans . A test vector was co-injected. This test vector encodes for GFP under the control of a T7 promoter (pGN401 in FIG. 13). The plasmid pGN401 was constructed by inserting two overlapping oligo's oGN41 (CCCGGGATTAATACGACTCACTATA; SEQ ID NO:23) and oGN42 (CCGGTATAGTGAGTCGTATTAATCCCGGGAGCT; SEQ ID NO:24) in the SacI/AgeI opened Fire vector pPD97.82, generating a T7 promoter. Furthermore a selection marker was co-injected to select for transformants (rol6, pRF4). The latter selection vector pRF4 is well known to persons skilled in the art. Transgenic F1 could easy be isolated as they display the rol 6 phenotype. These transgenic C. elegans all expressed GFP in the pharynx, the vulval muscle, the tail and the body wall muscle. This data show clearly that the T7 RNA polymerase is functionally expressed under the regulation of the SERCA promoter, and that the expressed T7 RNA polymerase binds to the T7 promoter present in pGN401 and initiates transcription of the GFP gene, which is then functionally expressed, resulting in fluorescence in the muscle tissues where SERCA is inducing the expression of the T7 RNA polymerase.
Example 3
[0133] Construction of a Vector for Ubiquitous Expression of T7 Polymerase in C. elegans
[0134] The NLS-T7 RNA polymerase fusion gene was isolated from pGN 1 O 8 with XmaI/Bsp1201 and cloned into the Fire vector pPD103.05 digested with XmaI/Bsp120I. This results in a vector wherein the T7 RNA polymerase is cloned under the regulation of the let858 promoter. This specific promoter enables the expression of T7 RNA polymerase in all tissues. The resulting plasmid was named pGN110 (FIG. 14)
Example 4
[0135] Construction of a Vector for T7 RNA Polymerase Mediated Expression of DNA Fragments, Genes, and cDNA's Under the Control of a T7 Promoter
[0136] The Fire vector pPD97.82 was digested with SacI/AgeI and a T7 promoter sequence was generated by insertion of two overlapping oligo's oGN41 (CCCGGGATTAATACGACTCACTATA; SEQ ID NO:23) and oGN42 (CCGGTATAGTGAGTCGTATTAATCCCGGGAGCT; SEQ ID NO:24) into the SacI/Age/restriction endonuclease sites. This construct (pGN400 FIG. 12) contains a GFP open reading frame cloned between SacI and EcoRI restriction endonuclease sites under the regulation of the T7 promoter. Any gene, cDNA, or DNA fragment can be cloned in this vector by deleting the GFP gene as a AgeI/SacI fragment and cloning the DNA fragment of interest into the vector. Preferentially the DNA fragment of interest can be obtained by PCR amplification, inserting the SacI/AfeI sites in the primers. The resulting DNA fragment after PCR amplification is the digested and the GFP gene in pGN400 is replaced by the amplified DNA fragment. Every vector that contains a T7 promoter could be used for the purpose of T7 RNA polymerase induced expression in C. elegans , such as the commercially available pGEM vectors and the pBluescript vectors. This is clearly shown by the pGN401 vector which expresses GFP under the regulation of the T7 promoter in a transgenic C. elegans which expresses T7 RNA polymerase.
[0137] The use of pGN400 has the advantage that the vector includes a 3′UTR fragment from unc-54 which enhances the transcription or stability of the RNA.
[0138] Generation of Permanent, Tissue Specific “Pseudo knock-out” RNAi C elegans Lines
[0139] At present, gene knock outs in C. elegans are obtained after random, large scale mutagenesis and PCR based sib-selection. This method is bulky, very time consuming and tedious. It has been described that introducing double stranded RNA into a cell results in potent and specific interference of expression of endogenous genes. In C. elegans gene expression can be down regulated by injection of RNA into the body cavity of the worm, soaking the worm in a solution containing dsRNA or feeding E. coli that express dsRNA corresponding to the gene of interest. C. elegans cells have the ability to take in dsRNA from their extracellular environment. It has been reported that mRNA is the target of this ds RNA mediated genetic interference (Montgomery and Fire 1998). It is also suggested that the targeted RNA is degraded in the nucleus before translation can occur. Although the RNAi mediated reduction of gene expression can be passed on to the next generations, heritability is poor and the effect is rapidly lost during further offspring. This is probably due to a continued decrease of the dsRNA pool. We propose here a method to construct C. elegans lines with a permanent, inheritable, RNAi phenotype. The method encompasses the generation of transgenic C. elegans lines by introducing plasmids containing cDNA fragments of the target gene in the sense and antisense orientation under control of a worm promoter or by transcription of an inverted repeat of the cDNA from a single construct. Alternatively, ds RNA can be transcribed from a vector harboring a cDNA flanked by two T7 promoters in a C. elegans strain that expresses T7 polymerase. The result is a transgenic worm with an heritable stable “pseudo knock-out” phenotype. The expression of the cDNA or the T7 polymerase can be general and constitutive but could also be regulated under a tissue specific promoter. In contrast to RNAi induced by external ds RNAi (injected, soaked or feeded) this method would enable to obtain conditional, tissue specific inhibition of gene expression.
[0140] Inhibition of unc-22 Expression by RNA Interference Results in a “Twitching” Phenotype
[0141] Unc 22 cDNA (exon 22) was cloned in sense and antisense orientation in pPD103.05. (A. Fire nr L2865) containing the let 858 promoter that is capable of expressing RNA sequences in all tissues. The resulting plasmids were named pGN 2 O 5 (FIG. 19 a ) and pGN 2 O 7 (FIG. 19 b ). These constructs were introduced into C. elegans together with a selectable marker (rol-6; GFP). Transgenic F1 individuals (expressing rol-6 or GFP) showed a “twitching” phenotype indicating that RNAi could be mediated by endogenous transcription of RNA from transgenic DNA. The RNAi phenotype co-segregated with the selectable marker into further offspring. This resulted in the generation of C. elegans lines with permanent RNAi phenotype.
[0142] Generation of Stable Lines T7 RNA Polymerase Lines and Generation of Dual Transgenic Worms
[0143] An expression system in C. elegans based on an exogenous RNA polymerase demands two plasmids. One is encoded for the RNA polymerase under the control of a specific promoter, while the other plasmid encodes for the DNA fragment to be expressed, under the regulation of the T7 promoter. In the case of semi stable RNAi also designated pseudo stable knockouts, the DNA of interest is cloned between two T7 promoters so that dsRNA can be produced.
[0144] As the T7 RNA polymerase expression system is known to be a high expression system this will result in problems to generate dually transgenic animals. If the gene to be expressed in the C. elegans nematode is toxic, this will result in lethal effects and hence in the construction of a C. elegans without highly regulated stable expression of the gene of interest. If the gene of interest is essential for the survival of the organism, RNAi with a DNA fragment from this gene will also result in lethal effects, so that pseudo-stable knockouts are not possible.
[0145] To overcome this problem the present inventors have designed a system consisting of two transgenic animals. The first animal is transgenic for the T7 RNA polymerase, This T7 RNA polymerase can be expressed in all cells or specific cells or tissues as has been shown in previous examples. The second transgenic animal is transgenic for the DNA fragment of interest. This can be a gene or cDNA linked to a T7 promoter, or if one wants to perform RNAi a DNA fragment of such gene cloned between two T7 promoters.
[0146] Both transgenic animals are viable and do not show any aberrant phenotypes. This is because the T7 RNA polymerase expressed in the first transgenic organism is not toxic for the organism, even if expressed at relative high levels. In the second transgenic organism, the gene of interest is not expressed or the dsRNA is not produced as these transgenic animals do not contain the T7 RNA polymerase.
[0147] Expression of the gene or cDNA of interest or RNAi with a DNA fragment can now be obtained by mating the two transgenic animals. The offspring of these are dually transgenic and express the gene of interest or express dsRNA of the DNA fragment of interest. To generate sufficient males in such a mating, one of the transgenic animals males can be a C. elegans mutant with a phenotype favouring generation of males. An example of such a mutant is him-5. Preferentially such a mutant will be used to make a C. elegans transgenic for T7 RNA polymerase, while the hermaphrodite harbors the DNA fragment under the regulation of the T7 promoter.
[0148] To select efficiently for the dual transgenic offspring a second transgene can be introduced in the second transgenic animal. This transgene contains a reporter gene under the regulation of the T7 promoter. The reporter gene can be GFP, luciferase, Beta galactosidase; or beta-lactamase. An example of such a transgene are the vectors pGN400 and pGN401.
[0149] To obtain inducible, tissue specific expression of a transgene in C. elegans we can make male stock (i.e. him-5) carrying the T7 polymerase construct under the control of different C. elegans promoters that enable tissue specific expression such as). These males can be crossed with hermaphrodites carrying the gene of interest under the control of a T7 promoter.
[0150] Furthermore, the transgenes can be integrated into the genome of the animal. Methods to generate stable integration of a plasmid into the genome of the animal have been described (Methods in Cell Biology, Vol. 48, 1995, ed. by Epstein and Shakes, Academic Press) and involve radiation of the animal. This can be done for both animals, but preferentially, the animals expressing the T7 RNA polymerase are subject to such treatment. This result in a collection of C. elegans nematodes that stably express T7 RNA polymerase under the control of various promoters. Examples of such promoters are the myo-2 (pharynx expression), myo-3 (body wall muscles), egl-15 (vulval muscles), unc-119 (pan-neuron), SERCA (muscles), let858 (all cells) ges-1 (gut).
[0151] Construction of RNAI T7 Promoter Yeast Two Hybrid Vectors
[0152] pGAD424 with Forward and Reverse T7/T3 and or Sp6
[0153] In most two-hybrid experiments a cDNA library is cloned in plasmid pGAD424 (FIG. 16) which has been engineered with additional restriction sites in the polylinker such as a Nco1 site (Clontech). This library allows for screening of binding proteins in a yeast two hybrid experiment. We constructed a new yeast two hybrid vector with the same possiblilities to perform yeast two hybrid, but which contain two additional T7 promoters, so that the vector can be used for T7 RNA polymerase induced pseudo-stable knock-outs. For this we inserted a forward T7 by using a T7-linker (consisting of the following primers aattcttaatacgactcactatagggcc (SEQ ID NO:25) and catgggccctatagtgagtcgtattaag (SEQ ID NO:26)) into the EcoRI-Ncol site of pGAD424. The resulting vector was designated pGAD424-without-FULL-ICE-both-T7. Care was taken to eliminate stop codons and using maximal polylinker compatible amino acids. We adopted the same strategy for the reverse T7 (consisting of both primers gatccgtcgacagatctccctatagtgagtcgtattactgca (SEQ ID NO:27) and gtaatacgactcactatagggagatctgtcgacg (SEQ ID NO:28)) with BamH1 and Pst1. To avoid loss of SalI, we included this site in the primer.
[0154] The SalI site is important as most libraries are cloned in this site, adapters are available. This makes the newly constructed vector compatible with existing vectors.
[0155] pAS2 with with Forward and Reverse T7/T3 and or Sp6
[0156] An analogous yeast two hybrid vector was constructed based on pAS2 (Clontech). By partial EcoRV digestion we were able to remove a significant part of the cyh2 gene. The right construct can be isolated and checked by a restriction digest with BglII. this restriction site is present in the EcoRV fragment of PAS2 to be eliminated. This elimates the cyh2 gene which is slightly toxic gene and involved in growth retardation. This gene is non-essential for the performing of RNAi and Yeast two hybrid experiments. After the elimination of the EcoRV fragment, The EcoRI restriction site which is located between the DNA sequence encoding for GAL4 DB and HA (epitope) becomes unique for the plasmid, and can be used to subsitute HA with a T7 promoter containing linker. This ensures persistence of all restriction sites, allowing both in frame cloning and compatibility with previous vectors and pGAD424. We used the following linker (primers:_aattcttaatacgactcactatagggcc (SEQ ID NO:25) and tatgccctatagtgagtcgtattaag (SEQ ID NO:29)) using EcoRI and Nde1 cloning sites. We adopted the same strategy for the reverse T7 (primers: gatccgtcgacagatctccctatagtgagtcgtattactgca (SEQ ID NO:27) and gtaatacgactcactatagggagatctgtcgacg (SEQ ID NO:28)) with BamH1 and Pst1. To avoid loss of Sal1 we included it in the primer. The resulting vector was designated pAS2-cyh2-HA+both T7-final.
[0157] Having the T7 promoter (or alternatively the T3, or SP6 promoter) in pGAD424 allows to go quickly from interacting protein to RNAi and assigning function to the isolated DNA fragment. An additional advantage is the ability to make by in vitro transcription coupled to in vitro translation (There is an ATG in frame with either GAL4 DB or GAL4AD) labeled protein which can be used for in vitro controls (e.g. pull down assays) of the actual protein-protein interaction.
[0158] The sequences of the plasmids produced and the SP6 and T3 polymerase are identified in the Sequence Listing provided below:



1


29


1
3216
DNA
Artificial Sequence

Description of Artificial Sequenceplasmid DNA


1

gagtgcacca tatgcggtgt gaaataccgc acagatgcgt aaggagaaaa taccgcatca 60

ggcgaaattg taaacgttaa tattttgtta aaattcgcgt taaatatttg ttaaatcagc 120

tcatttttta accaataggc cgaaatcggc aaaatccctt ataaatcaaa agaatagacc 180

gagatagggt tgagtgttgt tccagtttgg aacaagagtc cactattaaa gaacgtggac 240

tccaacgtca aagggcgaaa aaccgtctat cagggcgatg gcccactacg tgaaccatca 300

cccaaatcaa gttttttgcg gtcgaggtgc cgtaaagctc taaatcggaa ccctaaaggg 360

agcccccgat ttagagcttg acggggaaag ccggcgaacg tggcgagaaa ggaagggaag 420

aaagcgaaag gagcgggcgc tagggcgctg gcaagtgtag cggtcacgct gcgcgtaacc 480

accacacccg ccgcgcttaa tgcgccgcta cagggcgcgt ccattcgcca ttcaggctgc 540

gcaactgttg ggaagggcga tcggtgcggg cctcttcgct attacgccag ctggcgaaag 600

ggggatgtgc tgcaaggcga ttaagttggg taacgccagg gttttcccag tcacgacgtt 660

gtaaaacgac ggccagtgaa ttgtaatacg actcactata gggcgaattc gagctcggta 720

cccggggatc ctctagagtc gaaagcttct cgccctatag tgagtcgtat tacagcttga 780

gtattctata gtgtcaccta aatagcttgg cgtaatcatg gtcatagctg tttcctgtgt 840

gaaattgtta tccgctcaca attccacaca acatacgagc cggaagcata aagtgtaaag 900

cctggggtgc ctaatgagtg agctaactca cattaattgc gttgcgctca ctgcccgctt 960

tccagtcggg aaacctgtcg tgccagctgc attaatgaat cggccaacgc gcggggagag 1020

gcggtttgcg tattgggcgc tcttccgctt cctcgctcac tgactcgctg cgctcggtcg 1080

ttcggctgcg gcgagcggta tcagctcact caaaggcggt aatacggtta tccacagaat 1140

caggggataa cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta 1200

aaaaggccgc gttgctggcg tttttcgata ggctccgccc ccctgacgag catcacaaaa 1260

atcgacgctc aagtcagagg tggcgaaacc cgacaggact ataaagatac caggcgtttc 1320

cccctggaag ctccctcgtg cgctctcctg ttccgaccct gccgcttacc ggatacctgt 1380

ccgcctttct cccttcggga agcgtggcgc tttctcatag ctcacgctgt aggtatctca 1440

gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc gttcagcccg 1500

accgctgcgc cttatccggt aactatcgtc ttgagtccaa cccggtaaga cacgacttat 1560

cgccactggc agcagccact ggtaacagga ttagcagagc gaggtatgta ggcggtgcta 1620

cagagttctt gaagtggtgg cctaactacg gctacactag aaggacagta tttggtatct 1680

gcgctctgct gaagccagtt accttcggaa aaagagttgg tagctcttga tccggcaaac 1740

aaaccaccgc tggtagcggt ggtttttttg tttgcaagca gcagattacg cgcagaaaaa 1800

aaggatctca agaagatcct ttgatctttt ctacggggtc tgacgctcag tggaacgaaa 1860

actcacgtta agggattttg gtcatgagat tatcaaaaag gatcttcacc tagatccttt 1920

taaattaaaa atgaagtttt aaatcaatct aaagtatata tgagtaaact tggtctgaca 1980

gttaccaatg cttaatcagt gaggcaccta tctcagcgat ctgtctattt cgttcatcca 2040

tagttgcctg actccccgtc gtgtagataa ctacgatacg ggagggctta ccatctggcc 2100

ccagtgctgc aatgataccg cgagacccac gctcaccggc tccagattta tcagcaataa 2160

accagccagc cggaagggcc gagcgcagaa gtggtcctgc aactttatcc gcctccatcc 2220

agtctattaa ttgttgccgg gaagctagag taagtagttc gccagttaat agtttgcgca 2280

acgttgttgg cattgctaca ggcatcgtgg tgtcacgctc gtcgtttggt atggcttcat 2340

tcagctccgg ttcccaacga tcaaggcgag ttacatgatc ccccatgttg tgcaaaaaag 2400

cggttagctc cttcggtcct ccgatcgttg tcagaagtaa gttggccgca gtgttatcac 2460

tcatggttat ggcagcactg cataattctc ttactgtcat gccatccgta agatgctttt 2520

ctgtgactgg tgagtactca accaagtcat tctgagaata ccgcgcccgg cgaccgagtt 2580

gctcttgccc ggcgtcaata cgggataata gtgtatgaca tagcagaact ttaaaagtgc 2640

tcatcattgg aaaacgttct tcggggcgaa aactctcaag gatcttaccg ctgttgagat 2700

ccagttcgat gtaacccact cgtgcaccca actgatcttc agcatctttt actttcacca 2760

gcgtttctgg gtgagcaaaa acaggaaggc aaaatgccgc aaaaaaggga ataagggcga 2820

cacggaaatg ttgaatactc atactcttcc tttttcaata ttattgaagc atttatcagg 2880

gttattgtct catgagcgga tacatatttg aatgtattta gaaaaataaa caaatagggg 2940

ttccgcgcac atttccccga aaagtgccac ctgacgtcta agaaaccatt attatcatga 3000

cattaaccta taaaaatagg cgtatcacga ggccctttcg tctcgcgcgt ttcggtgatg 3060

acggtgaaaa cctctgacac atgcagctcc cggagacggt cacagcttgt ctgtaagcgg 3120

atgccgggag cagacaagcc cgtcagggcg cgtcagcggg tgttggcggg tgtcggggct 3180

ggcttaacta tgcggcatca gagcagattg tactga 3216



2
6460
DNA
Artificial Sequence

Description of Artificial Sequenceplasmid DNA


2

ctagcatgaa cacgattaac atcgctaaga acgacttctc tgacatcgaa ctggctgcta 60

tcccgttcaa cactctggct gaccattacg gtgagcgttt agctcgcgaa cagttggccc 120

ttgagcatga gtcttacgag atgggtgaag cacgcttccg caagatgttt gagcgtcaac 180

ttaaagctgg tgaggttgcg gataacgctg ccgccaagcc tctcatcact accctactcc 240

ctaagatgat tgcacgcatc aacgactggt ttgaggaagt gaaagctaag cgcggcaagc 300

gcccgacagc cttccagttc ctgcaagaaa tcaagccgga agccgtagcg tacatcacca 360

ttaagaccac tctggcttgc ctaaccagtg ctgacaatac aaccgttcag gctgtagcaa 420

gcgcaatcgg tcgggccatt gaggacgagg ctcgcttcgg tcgtatccgt gaccttgaag 480

ctaagcactt caagaaaaac gttgaggaac aactcaacaa gcgcgtaggg cacgtctaca 540

agaaagcatt tatgcaagtt gtcgaggctg acatgctctc taagggtcta ctcggtggcg 600

aggcgtggtc ttcgtggcat aaggaagact ctattcatgt aggagtacgc tgcatcgaga 660

tgctcattga gtcaaccgga atggttagct tacaccgcca aaatgctggc gtagtaggtc 720

aagactctga gactatcgaa ctcgcacctg aatacgctga ggctatcgca acccgtgcag 780

gtgcgctggc tggcatctct ccgatgttcc aaccttgcgt agttcctcct aagccgtgga 840

ctggcattac tggtggtggc tattgggcta acggtcgtcg tcctctggcg ctggtgcgta 900

ctcacagtaa gaaagcactg atgcgctacg aagacgttta catgcctgag gtgtacaaag 960

cgattaacat tgcgcaaaac accgcatgga aaatcaacaa gaaagtccta gcggtcgcca 1020

acgtaatcac caagtggaag cattgtccgg tcgaggacat ccctgcgatt gagcgtgaag 1080

aactcccgat gaaaccggaa gacatcgaca tgaatcctga ggctctcacc gcgtggaaac 1140

gtgctgccgc tgctgtgtac cgcaaggaca gggctcgcaa gtctcgccgt atcagccttg 1200

agttcatgct tgagcaagcc aataagtttg ctaaccataa ggccatctgg ttcccttaca 1260

acatggactg gcgcggtcgt gtttacgccg tgtcaatgtt caacccgcaa ggtaacgata 1320

tgaccaaagg actgcttacg ctggcgaaag gtaaaccaat cggtaaggaa ggttactact 1380

ggctgaaaat ccacggtgca aactgtgcgg gtgtcgataa ggttccgttc cctgagcgca 1440

tcaagttcat tgaggaaaac cacgagaaca tcatggcttg cgctaagtct ccactggaga 1500

acacttggtg ggctgagcaa gattctccgt tctgcttcct tgcgttctgc tttgagtacg 1560

ctggggtaca gcaccacggc ctgagctata actgctccct tccgctggcg tttgacgggt 1620

cttgctctgg catccagcac ttctccgcga tgctccgaga tgaggtaggt ggtcgcgcgg 1680

ttaacttgct tcctagtgag accgttcagg acatctacgg gattgttgct aagaaagtca 1740

acgagattct acaagcagac gcaatcaatg ggaccgataa cgaagtagtt accgtgaccg 1800

atgagaacac tggtgaaatc tctgagaaag tcaagctggg cactaaggca ctggctggtc 1860

aatggctggc tcacggtgtt actcgcagtg tgactaagcg ttcagtcatg acgctggctt 1920

acgggtccaa agagttcggc ttccgtcaac aagtgctgga agataccatt cagccagcta 1980

ttgattccgg caagggtccg atgttcactc agccgaatca ggctgctgga tacatggcta 2040

agctgatttg ggaatctgtg agcgtgacgg tggtagctgc ggttgaagca atgaactggc 2100

ttaagtctgc tgctaagctg ctggctgctg aggtcaaaga taagaagact ggagagattc 2160

ttcgcaagcg ttgcgctgtg cattgggtaa ctcctgatgg tttccctgtg tggcaggaat 2220

acaagaagcc tattcagacg cgcttgaacc tgatgttcct cggtcagttc cgcttacagc 2280

ctaccattaa caccaacaaa gatagcgaga ttgatgcaca caaacaggag tctggtatcg 2340

ctcctaactt tgtacacagc caagacggta gccaccttcg taagactgta gtgtgggcac 2400

acgagaagta cggaatcgaa tcttttgcac tgattcacga ctccttcggt accattccgg 2460

ctgacgctgc gaacctgttc aaagcagtgc gcgaaactat ggttgacaca tatgagtctt 2520

gtgatgtact ggctgatttc tacgaccagt tcgctgacca gttgcacgag tctcaattgg 2580

acaaaatgcc agcacttccg gctaaaggta acttgaacct ccgtgacatc ttagagtcgg 2640

acttcgcgtt cgcgtaacca tggtattgat atctgagctc cgcatcggcc gctgtcatca 2700

gatcgccatc tcgcgcccgt gcctctgact tctaagtcca attactcttc aacatcccta 2760

catgctcttt ctccctgtgc tcccaccccc tatttttgtt attatcaaaa aaacttcttc 2820

ttaatttctt tgttttttag cttcttttaa gtcacctcta acaatgaaat tgtgtagatt 2880

caaaaataga attaattcgt aataaaaagt cgaaaaaaat tgtgctccct ccccccatta 2940

ataataattc tatcccaaaa tctacacaat gttctgtgta cacttcttat gtttttttta 3000

cttctgataa attttttttg aaacatcata gaaaaaaccg cacacaaaat accttatcat 3060

atgttacgtt tcagtttatg accgcaattt ttatttcttc gcacgtctgg gcctctcatg 3120

acgtcaaatc atgctcatcg tgaaaaagtt ttggagtatt tttggaattt ttcaatcaag 3180

tgaaagttta tgaaattaat tttcctgctt ttgctttttg ggggtttccc ctattgtttg 3240

tcaagagttt cgaggacggc gtttttcttg ctaaaatcac aagtattgat gagcacgatg 3300

caagaaagat cggaagaagg tttgggtttg aggctcagtg gaaggtgagt agaagttgat 3360

aatttgaaag tggagtagtg tctatggggt ttttgcctta aatgacagaa tacattccca 3420

atataccaaa cataactgtt tcctactagt cggccgtacg ggccctttcg tctcgcgcgt 3480

ttcggtgatg acggtgaaaa cctctgacac atgcagctcc cggagacggt cacagcttgt 3540

ctgtaagcgg atgccgggag cagacaagcc cgtcagggcg cgtcagcggg tgttggcggg 3600

tgtcggggct ggcttaacta tgcggcatca gagcagattg tactgagagt gcaccatatg 3660

cggtgtgaaa taccgcacag atgcgtaagg agaaaatacc gcatcaggcg gccttaaggg 3720

cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt cttagacgtc 3780

aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt tctaaataca 3840

ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat aatattgaaa 3900

aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt 3960

ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca 4020

gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag 4080

ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc tatgtggcgc 4140

ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac actattctca 4200

gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt 4260

aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca acttacttct 4320

gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg gggatcatgt 4380

aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga 4440

caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg gcgaactact 4500

tactctagct tcccggcaac aattaataga ctggatggag gcggataaag ttgcaggacc 4560

acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg gagccggtga 4620

gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct cccgtatcgt 4680

agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac agatcgctga 4740

gataggtgcc tcactgatta agcattggta actgtcagac caagtttact catatatact 4800

ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga tcctttttga 4860

taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt cagaccccgt 4920

agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct gctgcttgca 4980

aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc taccaactct 5040

ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgtcc ttctagtgta 5100

gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc tcgctctgct 5160

aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg ggttggactc 5220

aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt cgtgcacaca 5280

gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg agcattgaga 5340

aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg 5400

aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt atagtcctgt 5460

cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag gggggcggag 5520

cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt gctggccttt 5580

tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta ttaccgcctt 5640

tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt cagtgagcga 5700

ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc cgattcatta 5760

atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca acgcaattaa 5820

tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc cggctcgtat 5880

gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg accatgatta 5940

cgccaagctt gcatgcctgc aggtcgactc tagaggatca agagcatttg aatcagaata 6000

tggagaacgg agcatgagca ttttcgaagt tttttagatg cactagaaca aagcgtgttg 6060

gcttcctctg agcccgcttt ccttatatac ccgcattctg cagccttaca gaatgttcta 6120

gaaggtccta gatgcattcg tttgaaaata ctcccggtgg gtgcaaagag acgcagacgg 6180

aaaatgtatc tgggtctctt tattgtgtac actacttttc catgtaccga atgtgagtcg 6240

ccctcctttt gcaacaagca gctcgaatgt tctagaaaaa ggtggaaaat agtataaata 6300

ccgttgaaaa taaataccga acaacatttg ctctaattgt gaaattagaa atcttcaaac 6360

tataatcatc tcactggatc cccgggattg gccaaaggac ccaaaggtat gtttcgaatg 6420

atactaacat aacatagaac attttcagga ggacccttgg 6460



3
8330
DNA
Artificial Sequence

Description of Artificial Sequenceplasmid DNA


3

gttgtcgtaa agagatgttt ttattttact ttacaccggg tcctctctct ctgccagcac 60

agctcagtgt tggctgtgtg ctcgggctcc tgccaccggc ggcctcatct tcttcttctt 120

cttctctcct gctctcgctt atcacttctt cattcattct tattcctttt catcatcaaa 180

ctagcatttc ttactttatt tatttttttc aattttcaat tttcagataa aaccaaacta 240

cttgggttac agccgtcaac agatccccgg gattggccaa aggacccaaa ggtatgtttc 300

gaatgatact aacataacat agaacatttt caggaggacc cttgcttgga gggtaccgga 360

tgactgctcc aaagaagaag cgtaagctca tgaacacgat taacatcgct aagaacgact 420

tctctgacat cgaactggct gctatcccgt tcaacactct ggctgaccat tacggtgagc 480

gtttagctcg cgaacagttg gcccttgagc atgagtctta cgagatgggt gaagcacgct 540

tccgcaagat gtttgagcgt caacttaaag ctggtgaggt tgcggataac gctgccgcca 600

agcctctcat cactacccta ctccctaaga tgattgcacg catcaacgac tggtttgagg 660

aagtgaaagc taagcgcggc aagcgcccga cagccttcca gttcctgcaa gaaatcaagc 720

cggaagccgt agcgtacatc accattaaga ccactctggc ttgcctaacc agtgctgaca 780

atacaaccgt tcaggctgta gcaagcgcaa tcggtcgggc cattgaggac gaggctcgct 840

tcggtcgtat ccgtgacctt gaagctaagc acttcaagaa aaacgttgag gaacaactca 900

acaagcgcgt agggcacgtc tacaagaaag catttatgca agttgtcgag gctgacatgc 960

tctctaaggg tctactcggt ggcgaggcgt ggtcttcgtg gcataaggaa gactctattc 1020

atgtaggagt acgctgcatc gagatgctca ttgagtcaac cggaatggtt agcttacacc 1080

gccaaaatgc tggcgtagta ggtcaagact ctgagactat cgaactcgca cctgaatacg 1140

ctgaggctat cgcaacccgt gcaggtgcgc tggctggcat ctctccgatg ttccaacctt 1200

gcgtagttcc tcctaagccg tggactggca ttactggtgg tggctattgg gctaacggtc 1260

gtcgtcctct ggcgctggtg cgtactcaca gtaagaaagc actgatgcgc tacgaagacg 1320

tttacatgcc tgaggtgtac aaagcgatta acattgcgca aaacaccgca tggaaaatca 1380

acaagaaagt cctagcggtc gccaacgtaa tcaccaagtg gaagcattgt ccggtcgagg 1440

acatccctgc gattgagcgt gaagaactcc cgatgaaacc ggaagacatc gacatgaatc 1500

ctgaggctct caccgcgtgg aaacgtgctg ccgctgctgt gtaccgcaag acaaggctcg 1560

caagtctcgc cgtatcagcc ttgagttcat gcttgagcaa gccaataagt ttgctaacca 1620

taaggccatc tggttccctt acaacatgga ctggcgcggt tcgtgtttac gctgtgtcaa 1680

tgttcaaccc gcaaggtaac gatatgacca aaggacgtct tacgctggcg aaaggtaaac 1740

caatcggtaa ggaaggttac tactggctga aaatccacgg tgcaaactgt gcgggtgtcg 1800

ataaggtttc gtttcctgag cgcatcaagt tcattgagga aaaccacgag aacatcatgg 1860

cttgcgctaa gtctccactg gagaacactt ggtgggctga gcaagattct ccgttctgct 1920

tccttgcgtt ctgctttgag tacgctgggg tacagcacca cggcctgagc tataactgct 1980

cccttccgct ggcgtttgac gggtcttgct ctggcatcca gcacttctcc gcgatgctcc 2040

gagatgaggt aggtggtcgc gcggttaact tgcttcctag tgaaaccgtt caggacatct 2100

acgggattgt tgctaagaaa gtcaacgaga ttctgcaagc agacgcaatc aatgggaccg 2160

ataacgaagt agttaccgtg accgatgaga acactggtga aatctctgag aaagtcaagc 2220

tgggcactaa ggcactggct ggtcaatggc tggcttacgg tgttactcgc agtgtgacta 2280

agcgttcagt catgacgctg gcttacgggt ccaaagagtt cggcttccgt caacaagtgc 2340

tggaagatac cattcagcca gctattgatt ccggcaaggg tctgatgttc actcagccga 2400

atcaggctgc tggatacatg gctaagctga tttgggaatc cgtgagcgtg acggtggtag 2460

ctgcggttga agcaatgaac tggcttaagt ctgctgctaa gctgctggct gctgaggtca 2520

aagataagaa gactggagag attcttcgca agcgttgcgc tgtgcattgg gtaactcctg 2580

atggtttccc tgtgtggcag gaatacaaga agcctattca gacgcgcttg aacctgatgt 2640

tcctcggtca gttccgctta cagcctacca ttaacaccaa caaagatagc gagattgatg 2700

cacacaaaca ggagtctggt atcgctccta actttgtaca cagccaagac ggtagccacc 2760

ttcgtaagac tgtagtgtgg gcacacgaga agtacggaat cgaatctttt gcactgattc 2820

acgactcctt cggtaccatt ccggctgacg ctgcgaacct gttcaaagca gtgcgcgaaa 2880

ctatggttga cacatatgag tcttgtgatg tactggctga tttctacgac cagttcgctg 2940

accagttgca cgagtctcaa ttggacaaaa tgccagcact tccggctaaa ggtaacttga 3000

acctccgtga catcttagag tcggacttcg cgttcgcgta agggcccact agtcggccgt 3060

acgggccctt tcgtctcgcg cgtttcggtg atgacggtga aaacctctga cacatgcagc 3120

tcccggagac ggtcacagct tgtctgtaag cggatgccgg gagcagacaa gcccgtcagg 3180

gcgcgtcagc gggtgttggc gggtgtcggg gctggcttaa ctatgcggca tcagagcaga 3240

ttgtactgag agtgcaccat atgcggtgtg aaataccgca cagatgcgta aggagaaaat 3300

accgcatcag gcggccttaa gggcctcgtg atacgcctat ttttataggt taatgtcatg 3360

ataataatgg tttcttagac gtcaggtggc acttttcggg gaaatgtgcg cggaacccct 3420

atttgtttat ttttctaaat acattcaaat atgtatccgc tcatgagaca ataaccctga 3480

taaatgcttc aataatattg aaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc 3540

cttattccct tttttgcggc attttgcctt cctgtttttg ctcacccaga aacgctggtg 3600

aaagtaaaag atgctgaaga tcagttgggt gcacgagtgg gttacatcga actggatctc 3660

aacagcggta agatccttga gagttttcgc cccgaagaac gttttccaat gatgagcact 3720

tttaaagttc tgctatgtgg cgcggtatta tcccgtattg acgccgggca agagcaactc 3780

ggtcgccgca tacactattc tcagaatgac ttggttgagt actcaccagt cacagaaaag 3840

catcttacgg atggcatgac agtaagagaa ttatgcagtg ctgccataac catgagtgat 3900

aacactgcgg ccaacttact tctgacaacg atcggaggac cgaaggagct aaccgctttt 3960

ttgcacaaca tgggggatca tgtaactcgc cttgatcgtt gggaaccgga gctgaatgaa 4020

gccataccaa acgacgagcg tgacaccacg atgcctgtag caatggcaac aacgttgcgc 4080

aaactattaa ctggcgaact acttactcta gcttcccggc aacaattaat agactggatg 4140

gaggcggata aagttgcagg accacttctg cgctcggccc ttccggctgg ctggtttatt 4200

gctgataaat ctggagccgg tgagcgtggg tctcgcggta tcattgcagc actggggcca 4260

gatggtaagc cctcccgtat cgtagttatc tacacgacgg ggagtcaggc aactatggat 4320

gaacgaaata gacagatcgc tgagataggt gcctcactga ttaagcattg gtaactgtca 4380

gaccaagttt actcatatat actttagatt gatttaaaac ttcattttta atttaaaagg 4440

atctaggtga agatcctttt tgataatctc atgaccaaaa tcccttaacg tgagttttcg 4500

ttccactgag cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt 4560

ctgcgcgtaa tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg 4620

ccggatcaag agctaccaac tctttttccg aaggtaactg gcttcagcag agcgcagata 4680

ccaaatactg tccttctagt gtagccgtag ttaggccacc acttcaagaa ctctgtagca 4740

ccgcctacat acctcgctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag 4800

tcgtgtctta ccgggttgga ctcaagacga tagttaccgg ataaggcgca gcggtcgggc 4860

tgaacggggg gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga 4920

tacctacagc gtgagcattg agaaagcgcc acgcttcccg aagggagaaa ggcggacagg 4980

tatccggtaa gcggcagggt cggaacagga gagcgcacga gggagcttcc agggggaaac 5040

gcctggtatc tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg 5100

tgatgctcgt caggggggcg gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg 5160

ttcctggcct tttgctggcc ttttgctcac atgttctttc ctgcgttatc ccctgattct 5220

gtggataacc gtattaccgc ctttgagtga gctgataccg ctcgccgcag ccgaacgacc 5280

gagcgcagcg agtcagtgag cgaggaagcg gaagagcgcc caatacgcaa accgcctctc 5340

cccgcgcgtt ggccgattca ttaatgcagc tggcacgaca ggtttcccga ctggaaagcg 5400

ggcagtgagc gcaacgcaat taatgtgagt tagctcactc attaggcacc ccaggcttta 5460

cactttatgc ttccggctcg tatgttgtgt ggaattgtga gcggataaca atttcacaca 5520

ggaaacagct atgaccatga ttacgccaag ctgtaagttt aaacatgatc ttactaacta 5580

actattctca tttaaatttt cagagcttaa aaatggctga aatcactcac aacgatggat 5640

acgctaacaa cttggaaatg aaataagctt gcatgcctgc agagcaaaaa aatactgctt 5700

ttccttgcaa aattcggtgc tttcttcaaa gagaaacttt tgaagtcggc gcgagcattt 5760

ccttctttga cttctctctt tccgccaaaa agcctagcat ttttattgat aatttgatta 5820

cacacactca gagttcttcg acatgataaa gtgtttcatt ggcactcgcc ctaacagtac 5880

atgacaaggg cggattatta tcgatcgata ttgaagacaa actccaaatg tgtgctcatt 5940

ttggagcccc gtgtggggca gctgctctca atatattact agggagacga ggagggggac 6000

cttatcgaac gtcgcatgag ccattctttc ttctttatgc actctcttca ctctctcaca 6060

cattaatcga ttcatagact cccatattcc ttgatgaagg tgtgggtttt tagctttttt 6120

tcccgatttg taaaaggaag aggctgacga tgttaggaaa aagagaacgg agccgaaaaa 6180

acatccgtag taagtcttcc ttttaagccg acacttttta gacagcattc gccgctagtt 6240

ttgaagttta aattttaaaa aataaaaatt agtttcaatt ttttttaatt actaaatagg 6300

caaaagtttt ttcaagaact ctagaaaaac tagcttaatt catgggtact agaaaaattc 6360

ttgttttaaa tttaatattt atcttaagat gtaattacga gaagcttttt tgaaaattct 6420

caattaaaag aatttgccga tttagaataa aagtcttcag aaatgagtaa aagctcaaat 6480

tagaagtttg tttttaaagg aaaaacacga aaaaagaaca ctatttatct tttcctcccc 6540

gcgtaaaatt agttgttgtg ataatagtga tccgctgtct atttgcactc ggctcttcac 6600

accgtgcttc ctctcacttg acccaacagg aaaaaaaaac atcacgtctg agacggtgaa 6660

ttgccttatc aagagcgtcg tctctttcac ccagtaacaa aaaaaatttg gtttctttac 6720

tttatattta tgtaggtcac aaaaaaaaag tgatgcagtt ttgtgggtcg gttgtctcca 6780

caccacctcc gcctccagca gcacacaatc atcttcgtgt gttctcgacg attccttgta 6840

tgccgcggtc gtgaatgcac cacattcgac gcgcaactac acaccacact cactttcggt 6900

ggtattacta cacgtcatcg ttgttcgtag tctcccgctc tttcgtcccc actcactcct 6960

cattattccc cttggtgtat tgattttttt taaatggtac accactcctg acgtttctac 7020

cttcttgttt tccgtccatt tagattttat ctggaaattt ttttaaaatt ttaggccaga 7080

gagttctagt tcttgttcta aaagtctagg tcagacatac attttctatt tctcatcaaa 7140

aaaaaagttg ataaagaaaa ctggttattc agaaagagtg tgtctcgttg aaattgattc 7200

aaaaaaaaat tcccacccct cgcttgtttc tcaaaatatg agatcaacgg attttttcct 7260

tctcgattca attttttgct gcgctctgtc tgccaaagtg tgtgtgtccg agcaaaagat 7320

gagagaattt acaaacagaa atgaaaaaaa gttggccaaa taatgaagtt ttatccgaga 7380

ttgatgggaa agatattaat gttctttacg gtttggaggg gagagagaga tagattttcg 7440

catcaaactc cgccttttac atgtctttta gaatctaaaa tagatttttc tcatcatttt 7500

taatagaaaa tcgagaaatt acagtaattt cgcaattttc ttgccaaaaa tacacgaaat 7560

ttgtgggtct cgccacgatc tcggtcttag tggttcattt ggtttaaaag tttataaaat 7620

ttcaaattct agtgtttaat ttccgcataa ttggacctaa aatgggtttt tgtcatcatt 7680

ttcaacaaga aatcgtgaaa atcctgttgt ttcgcaattt tcttttcaaa aatacacgaa 7740

atatatggta atttcccgaa atattgaggg tctcgccacg atttcagtca cagtggccag 7800

gatttatcac gaaaaaagtt cgcctagtct cacatttccg gaaaaccgaa tctaaattag 7860

ttttttgtca tcattttgaa caaaaaatcg agacatccct atagtttcgc aattttcgtc 7920

gcttttctct ccaaaaatga cagtctagaa ttaaaattcg ctggaactgg gaccatgata 7980

tcttttctcc ccgtttttca ttttattttt tattacactg gattgactaa aggtcaccac 8040

caccgccagt gtgtgccata tcacacacac acacacacac aatgtcgaga ttttatgtgt 8100

tatccctgct tgatttcgtt ccgttgtctc tctctctcta ttcatctttt gagccgagaa 8160

gctccagaga atggagcaca caggatcccg gcgcgcgatg tcgtcgggag atggcgccgc 8220

ctgggaagcc gccgagagat atcagggaag atcgtctgat ttctcctcgg atgccacctc 8280

atctctcgag tttctccgcc tgttactccc tgccgaacct gatatttccc 8330



4
6470
DNA
Artificial Sequence

Description of Artificial Sequenceplasmid DNA


4

aagcttgcat gcctgcaggc cttggtcgac tctagacact tttcagctac ctagatacat 60

ggatatcccc gcctcccaat ccacccaccc agggaaaaag aagggctcgc cgaaaaatca 120

aagttatctc caggctcgcg catcccaccg agcggttgac ttctctccac cacttttcat 180

tttaaccctc ggggtacggg attggccaaa ggacccaaag gtatgtttcg aatgatacta 240

acataacata gaacattttc aggaggaccc ttgcttggag ggtaccgagc tcagaaaaaa 300

tgactgctcc aaagaagaag cgtaaggtac cggtaatgaa cacgattaac atcgctaaga 360

acgacttctc tgacatcgaa ctggctgcta tcccgttcaa cactctggct gaccattacg 420

gtgagcgttt agctcgcgaa cagttggccc ttgagcatga gtcttacgag atgggtgaag 480

cacgcttccg caagatgttt gagcgtcaac ttaaagctgg tgaggttgcg gataacgctg 540

ccgccaagcc tctcatcact accctactcc ctaagatgat tgcacgcatc aacgactggt 600

ttgaggaagt gaaagctaag cgcggcaagc gcccgacagc cttccagttc ctgcaagaaa 660

tcaagccgga agccgtagcg tacatcacca ttaagaccac tctggcttgc ctaaccagtg 720

ctgacaatac aaccgttcag gctgtagcaa gcgcaatcgg tcgggccatt gaggacgagg 780

ctcgcttcgg tcgtatccgt gaccttgaag ctaagcactt caagaaaaac gttgaggaac 840

aactcaacaa gcgcgtaggg cacgtctaca agaaagcatt tatgcaagtt gtcgaggctg 900

acatgctctc taagggtcta ctcggtggcg aggcgtggtc ttcgtggcat aaggaagact 960

ctattcatgt aggagtacgc tgcatcgaga tgctcattga gtcaaccgga atggttagct 1020

tacaccgcca aaatgctggc gtagtaggtc aagactctga gactatcgaa ctcgcacctg 1080

aatacgctga ggctatcgca acccgtgcag gtgcgctggc tggcatctct ccgatgttcc 1140

aaccttgcgt agttcctcct aagccgtgga ctggcattac tggtggtggc tattgggcta 1200

acggtcgtcg tcctctggcg ctggtgcgta ctcacagtaa gaaagcactg atgcgctacg 1260

aagacgttta catgcctgag gtgtacaaag cgattaacat tgcgcaaaac accgcatgga 1320

aaatcaacaa gaaagtccta gcggtcgcca acgtaatcac caagtggaag cattgtccgg 1380

tcgaggacat ccctgcgatt gagcgtgaag aactcccgat gaaaccggaa gacatcgaca 1440

tgaatcctga ggctctcacc gcgtggaaac gtgctgccgc tgctgtgtac cgcaaggaca 1500

gggctcgcaa gtctcgccgt atcagccttg agttcatgct tgagcaagcc aataagtttg 1560

ctaaccataa ggccatctgg ttcccttaca acatggactg gcgcggtcgt gtttacgccg 1620

tgtcaatgtt caacccgcaa ggtaacgata tgaccaaagg actgcttacg ctggcgaaag 1680

gtaaaccaat cggtaaggaa ggttactact ggctgaaaat ccacggtgca aactgtgcgg 1740

gtgtcgataa ggttccgttc cctgagcgca tcaagttcat tgaggaaaac cacgagaaca 1800

tcatggcttg cgctaagtct ccactggaga acacttggtg ggctgagcaa gattctccgt 1860

tctgcttcct tgcgttctgc tttgagtacg ctggggtaca gcaccacggc ctgagctata 1920

actgctccct tccgctggcg tttgacgggt cttgctctgg catccagcac ttctccgcga 1980

tgctccgaga tgaggtaggt ggtcgcgcgg ttaacttgct tcctagtgag accgttcagg 2040

acatctacgg gattgttgct aagaaagtca acgagattct acaagcagac gcaatcaatg 2100

ggaccgataa cgaagtagtt accgtgaccg atgagaacac tggtgaaatc tctgagaaag 2160

tcaagctggg cactaaggca ctggctggtc aatggctggc tcacggtgtt actcgcagtg 2220

tgactaagcg ttcagtcatg acgctggctt acgggtccaa agagttcggc ttccgtcaac 2280

aagtgctgga agataccatt cagccagcta ttgattccgg caagggtccg atgttcactc 2340

agccgaatca ggctgctgga tacatggcta agctgatttg ggaatctgtg agcgtgacgg 2400

tggtagctgc ggttgaagca atgaactggc ttaagtctgc tgctaagctg ctggctgctg 2460

aggtcaaaga taagaagact ggagagattc ttcgcaagcg ttgcgctgtg cattgggtaa 2520

ctcctgatgg tttccctgtg tggcaggaat acaagaagcc tattcagacg cgcttgaacc 2580

tgatgttcct cggtcagttc cgcttacagc ctaccattaa caccaacaaa gatagcgaga 2640

ttgatgcaca caaacaggag tctggtatcg ctcctaactt tgtacacagc caagacggta 2700

gccaccttcg taagactgta gtgtgggcac acgagaagta cggaatcgaa tcttttgcac 2760

tgattcacga ctccttcggt accattccgg ctgacgctgc gaacctgttc aaagcagtgc 2820

gcgaaactat ggttgacaca tatgagtctt gtgatgtact ggctgatttc tacgaccagt 2880

tcgctgacca gttgcacgag tctcaattgg acaaaatgcc agcacttccg gctaaaggta 2940

acttgaacct ccgtgacatc ttagagtcgg acttcgcgtt cgcgtaagaa ttccaactga 3000

gcgccggtcg ctaccattac caacttgtct ggtgtcaaaa ataatagggg ccgctgtcat 3060

cagagtaagt ttaaactgag ttctactaac taacgagtaa tatttaaatt ttcagcatct 3120

cgcgcccgtg cctctgactt ctaagtccaa ttactcttca acatccctac atgctctttc 3180

tccctgtgct cccaccccct atttttgtta ttatcaaaaa aacttcttct taatttcttt 3240

gttttttagc ttcttttaag tcacctctaa caatgaaatt gtgtagattc aaaaatagaa 3300

ttaattcgta ataaaaagtc gaaaaaaatt gtgctccctc cccccattaa taataattct 3360

atcccaaaat ctacacaatg ttctgtgtac acttcttatg ttttttttac ttctgataaa 3420

ttttttttga aacatcatag aaaaaaccgc acacaaaata ccttatcata tgttacgttt 3480

cagtttatga ccgcaatttt tatttcttcg cacgtctggg cctctcatga cgtcaaatca 3540

tgctcatcgt gaaaaagttt tggagtattt ttggaatttt tcaatcaagt gaaagtttat 3600

gaaattaatt ttcctgcttt tgctttttgg gggtttcccc tattgtttgt caagagtttc 3660

gaggacggcg tttttcttgc taaaatcaca agtattgatg agcacgatgc aagaaagatc 3720

ggaagaaggt ttgggtttga ggctcagtgg aaggtgagta gaagttgata atttgaaagt 3780

ggagtagtgt ctatggggtt tttgccttaa atgacagaat acattcccaa tataccaaac 3840

ataactgttt cctactagtc ggccgtacgg gccctttcgt ctcgcgcgtt tcggtgatga 3900

cggtgaaaac ctctgacaca tgcagctccc ggagacggtc acagcttgtc tgtaagcgga 3960

tgccgggagc agacaagccc gtcagggcgc gtcagcgggt gttggcgggt gtcggggctg 4020

gcttaactat gcggcatcag agcagattgt actgagagtg caccatatgc ggtgtgaaat 4080

accgcacaga tgcgtaagga gaaaataccg catcaggcgg ccttaagggc ctcgtgatac 4140

gcctattttt ataggttaat gtcatgataa taatggtttc ttagacgtca ggtggcactt 4200

ttcggggaaa tgtgcgcgga acccctattt gtttattttt ctaaatacat tcaaatatgt 4260

atccgctcat gagacaataa ccctgataaa tgcttcaata atattgaaaa aggaagagta 4320

tgagtattca acatttccgt gtcgccctta ttcccttttt tgcggcattt tgccttcctg 4380

tttttgctca cccagaaacg ctggtgaaag taaaagatgc tgaagatcag ttgggtgcac 4440

gagtgggtta catcgaactg gatctcaaca gcggtaagat ccttgagagt tttcgccccg 4500

aagaacgttt tccaatgatg agcactttta aagttctgct atgtggcgcg gtattatccc 4560

gtattgacgc cgggcaagag caactcggtc gccgcataca ctattctcag aatgacttgg 4620

ttgagtactc accagtcaca gaaaagcatc ttacggatgg catgacagta agagaattat 4680

gcagtgctgc cataaccatg agtgataaca ctgcggccaa cttacttctg acaacgatcg 4740

gaggaccgaa ggagctaacc gcttttttgc acaacatggg ggatcatgta actcgccttg 4800

atcgttggga accggagctg aatgaagcca taccaaacga cgagcgtgac accacgatgc 4860

ctgtagcaat ggcaacaacg ttgcgcaaac tattaactgg cgaactactt actctagctt 4920

cccggcaaca attaatagac tggatggagg cggataaagt tgcaggacca cttctgcgct 4980

cggcccttcc ggctggctgg tttattgctg ataaatctgg agccggtgag cgtgggtctc 5040

gcggtatcat tgcagcactg gggccagatg gtaagccctc ccgtatcgta gttatctaca 5100

cgacggggag tcaggcaact atggatgaac gaaatagaca gatcgctgag ataggtgcct 5160

cactgattaa gcattggtaa ctgtcagacc aagtttactc atatatactt tagattgatt 5220

taaaacttca tttttaattt aaaaggatct aggtgaagat cctttttgat aatctcatga 5280

ccaaaatccc ttaacgtgag ttttcgttcc actgagcgtc agaccccgta gaaaagatca 5340

aaggatcttc ttgagatcct ttttttctgc gcgtaatctg ctgcttgcaa acaaaaaaac 5400

caccgctacc agcggtggtt tgtttgccgg atcaagagct accaactctt tttccgaagg 5460

taactggctt cagcagagcg cagataccaa atactgtcct tctagtgtag ccgtagttag 5520

gccaccactt caagaactct gtagcaccgc ctacatacct cgctctgcta atcctgttac 5580

cagtggctgc tgccagtggc gataagtcgt gtcttaccgg gttggactca agacgatagt 5640

taccggataa ggcgcagcgg tcgggctgaa cggggggttc gtgcacacag cccagcttgg 5700

agcgaacgac ctacaccgaa ctgagatacc tacagcgtga gcattgagaa agcgccacgc 5760

ttcccgaagg gagaaaggcg gacaggtatc cggtaagcgg cagggtcgga acaggagagc 5820

gcacgaggga gcttccaggg ggaaacgcct ggtatcttta tagtcctgtc gggtttcgcc 5880

acctctgact tgagcgtcga tttttgtgat gctcgtcagg ggggcggagc ctatggaaaa 5940

acgccagcaa cgcggccttt ttacggttcc tggccttttg ctggcctttt gctcacatgt 6000

tctttcctgc gttatcccct gattctgtgg ataaccgtat taccgccttt gagtgagctg 6060

ataccgctcg ccgcagccga acgaccgagc gcagcgagtc agtgagcgag gaagcggaag 6120

agcgcccaat acgcaaaccg cctctccccg cgcgttggcc gattcattaa tgcagctggc 6180

acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc 6240

tcactcatta ggcaccccag gctttacact ttatgcttcc ggctcgtatg ttgtgtggaa 6300

ttgtgagcgg ataacaattt cacacaggaa acagctatga ccatgattac gccaagctgt 6360

aagtttaaac atgatcttac taactaacta ttctcattta aattttcaga gcttaaaaat 6420

ggctgaaatc actcacaacg atggatacgc taacaacttg gaaatgaaat 6470



5
4689
DNA
Artificial Sequence

Description of Artificial Sequenceplasmid DNA


5

aagcttgcat gcctgcaggc cttggtcgac tctagacact tttcagctac ctagatacat 60

ggatatcccc gcctcccaat ccacccaccc agggaaaaag aagggctcgc cgaaaaatca 120

aagttatctc caggctcgcg catcccaccg agcggttgac ttctctccac cacttttcat 180

tttaaccctc ggggtacggg attggccaaa ggacccaaag gtatgtttcg aatgatacta 240

acataacata gaacattttc aggaggaccc ttgcttggag ggtaccgagc tcccgggatt 300

aatacgactc actataccgg tagaaaaaat gagtaaagga gaagaacttt tcactggagt 360

tgtcccaatt cttgttgaat tagatggtga tgttaatggg cacaaatttt ctgtcagtgg 420

agagggtgaa ggtgatgcaa catacggaaa acttaccctt aaatttattt gcactactgg 480

aaaactacct gttccatggg taagtttaaa catatatata ctaactaacc ctgattattt 540

aaattttcag ccaacacttg tcactacttt ctgttatggt gttcaatgct tctcgagata 600

cccagatcat atgaaacggc atgacttttt caagagtgcc atgcccgaag gttatgtaca 660

ggaaagaact atatttttca aagatgacgg gaactacaag acacgtaagt ttaaacagtt 720

cggtactaac taaccataca tatttaaatt ttcaggtgct gaagtcaagt ttgaaggtga 780

tacccttgtt aatagaatcg agttaaaagg tattgatttt aaagaagatg gaaacattct 840

tggacacaaa ttggaataca actataactc acacaatgta tacatcatgg cagacaaaca 900

aaagaatgga atcaaagttg taagtttaaa catgatttta ctaactaact aatctgattt 960

aaattttcag aacttcaaaa ttagacacaa cattgaagat ggaagcgttc aactagcaga 1020

ccattatcaa caaaatactc caattggcga tggccctgtc cttttaccag acaaccatta 1080

cctgtccaca caatctgccc tttcgaaaga tcccaacgaa aagagagacc acatggtcct 1140

tcttgagttt gtaacagctg ctgggattac acatggcatg gatgaactat acaaatagca 1200

ttcgtagaat tccaactgag cgccggtcgc taccattacc aacttgtctg gtgtcaaaaa 1260

taataggggc cgctgtcatc agagtaagtt taaactgagt tctactaact aacgagtaat 1320

atttaaattt tcagcatctc gcgcccgtgc ctctgacttc taagtccaat tactcttcaa 1380

catccctaca tgctctttct ccctgtgctc ccacccccta tttttgttat tatcaaaaaa 1440

acttcttctt aatttctttg ttttttagct tcttttaagt cacctctaac aatgaaattg 1500

tgtagattca aaaatagaat taattcgtaa taaaaagtcg aaaaaaattg tgctccctcc 1560

ccccattaat aataattcta tcccaaaatc tacacaatgt tctgtgtaca cttcttatgt 1620

tttttttact tctgataaat tttttttgaa acatcataga aaaaaccgca cacaaaatac 1680

cttatcatat gttacgtttc agtttatgac cgcaattttt atttcttcgc acgtctgggc 1740

ctctcatgac gtcaaatcat gctcatcgtg aaaaagtttt ggagtatttt tggaattttt 1800

caatcaagtg aaagtttatg aaattaattt tcctgctttt gctttttggg ggtttcccct 1860

attgtttgtc aagagtttcg aggacggcgt ttttcttgct aaaatcacaa gtattgatga 1920

gcacgatgca agaaagatcg gaagaaggtt tgggtttgag gctcagtgga aggtgagtag 1980

aagttgataa tttgaaagtg gagtagtgtc tatggggttt ttgccttaaa tgacagaata 2040

cattcccaat ataccaaaca taactgtttc ctactagtcg gccgtacggg ccctttcgtc 2100

tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 2160

cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 2220

ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 2280

accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcggc 2340

cttaagggcc tcgtgatacg cctattttta taggttaatg tcatgataat aatggtttct 2400

tagacgtcag gtggcacttt tcggggaaat gtgcgcggaa cccctatttg tttatttttc 2460

taaatacatt caaatatgta tccgctcatg agacaataac cctgataaat gcttcaataa 2520

tattgaaaaa ggaagagtat gagtattcaa catttccgtg tcgcccttat tccctttttt 2580

gcggcatttt gccttcctgt ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct 2640

gaagatcagt tgggtgcacg agtgggttac atcgaactgg atctcaacag cggtaagatc 2700

cttgagagtt ttcgccccga agaacgtttt ccaatgatga gcacttttaa agttctgcta 2760

tgtggcgcgg tattatcccg tattgacgcc gggcaagagc aactcggtcg ccgcatacac 2820

tattctcaga atgacttggt tgagtactca ccagtcacag aaaagcatct tacggatggc 2880

atgacagtaa gagaattatg cagtgctgcc ataaccatga gtgataacac tgcggccaac 2940

ttacttctga caacgatcgg aggaccgaag gagctaaccg cttttttgca caacatgggg 3000

gatcatgtaa ctcgccttga tcgttgggaa ccggagctga atgaagccat accaaacgac 3060

gagcgtgaca ccacgatgcc tgtagcaatg gcaacaacgt tgcgcaaact attaactggc 3120

gaactactta ctctagcttc ccggcaacaa ttaatagact ggatggaggc ggataaagtt 3180

gcaggaccac ttctgcgctc ggcccttccg gctggctggt ttattgctga taaatctgga 3240

gccggtgagc gtgggtctcg cggtatcatt gcagcactgg ggccagatgg taagccctcc 3300

cgtatcgtag ttatctacac gacggggagt caggcaacta tggatgaacg aaatagacag 3360

atcgctgaga taggtgcctc actgattaag cattggtaac tgtcagacca agtttactca 3420

tatatacttt agattgattt aaaacttcat ttttaattta aaaggatcta ggtgaagatc 3480

ctttttgata atctcatgac caaaatccct taacgtgagt tttcgttcca ctgagcgtca 3540

gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg cgtaatctgc 3600

tgcttgcaaa caaaaaaacc accgctacca gcggtggttt gtttgccgga tcaagagcta 3660

ccaactcttt ttccgaaggt aactggcttc agcagagcgc agataccaaa tactgtcctt 3720

ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc tacatacctc 3780

gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg tcttaccggg 3840

ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac ggggggttcg 3900

tgcacacagc ccagcttgga gcgaacgacc tacaccgaac tgagatacct acagcgtgag 3960

cattgagaaa gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc 4020

agggtcggaa caggagagcg cacgagggag cttccagggg gaaacgcctg gtatctttat 4080

agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg 4140

gggcggagcc tatggaaaaa cgccagcaac gcggcctttt tacggttcct ggccttttgc 4200

tggccttttg ctcacatgtt ctttcctgcg ttatcccctg attctgtgga taaccgtatt 4260

accgcctttg agtgagctga taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca 4320

gtgagcgagg aagcggaaga gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg 4380

attcattaat gcagctggca cgacaggttt cccgactgga aagcgggcag tgagcgcaac 4440

gcaattaatg tgagttagct cactcattag gcaccccagg ctttacactt tatgcttccg 4500

gctcgtatgt tgtgtggaat tgtgagcgga taacaatttc acacaggaaa cagctatgac 4560

catgattacg ccaagctgta agtttaaaca tgatcttact aactaactat tctcatttaa 4620

attttcagag cttaaaaatg gctgaaatca ctcacaacga tggatacgct aacaacttgg 4680

aaatgaaat 4689



6
5175
DNA
Artificial Sequence

Description of Artificial Sequenceplasmid DNA


6

gatcccggcg cgcgatgtcg tcgggagatg gcgccgcctg ggaagccgcc gagagatatc 60

agggaagatc gtctgatttc tcctcggatg ccacctcatc tctcgagttt ctccgcctgt 120

tactccctgc cgaacctgat atttcccgtt gtcgtaaaga gatgttttta ttttacttta 180

caccgggtcc tctctctctg ccagcacagc tcagtgttgg ctgtgtgctc gggctcctgc 240

caccggcggc ctcatcttct tcttcttctt ctctcctgct ctcgcttatc acttcttcat 300

tcattcttat tccttttcat catcaaacta gcatttctta ctttatttat ttttttcaat 360

tttcaatttt cagataaaac caaactactt gggttacagc cgtcaacaga tccccgggat 420

tggccaaagg acccaaaggt atgtttcgaa tgatactaac ataacataga acattttcag 480

gaggaccctt gcttggaggg taccggtaga aaaaatgagt aaaggagaag aacttttcac 540

tggagttgtc ccaattcttg ttgaattaga tggtgatgtt aatgggcaca aattttctgt 600

cagtggagag ggtgaaggtg atgcaacata cggaaaactt acccttaaat ttatttgcac 660

tactggaaaa ctacctgttc catgggtaag tttaaacata tatatactaa ctaaccctga 720

ttatttaaat tttcagccaa cacttgtcac tactttctgt tatggtgttc aatgcttctc 780

gagataccca gatcatatga aacggcatga ctttttcaag agtgccatgc ccgaaggtta 840

tgtacaggaa agaactatat ttttcaaaga tgacgggaac tacaagacac gtaagtttaa 900

acagttcggt actaactaac catacatatt taaattttca ggtgctgaag tcaagtttga 960

aggtgatacc cttgttaata gaatcgagtt aaaaggtatt gattttaaag aagatggaaa 1020

cattcttgga cacaaattgg aatacaacta taactcacac aatgtataca tcatggcaga 1080

caaacaaaag aatggaatca aagttgtaag tttaaacttg gacttactaa ctaacggatt 1140

atatttaaat tttcagaact tcaaaattag acacaacatt gaagatggaa gcgttcaact 1200

agcagaccat tatcaacaaa atactccaat tggcgatggc cctgtccttt taccagacaa 1260

ccattacctg tccacacaat ctgccctttc gaaagatccc aacgaaaaga gagaccacat 1320

ggtccttctt gagtttgtaa cagctgctgg gattacacat ggcatggatg aactatacaa 1380

atagcattcg tagaattcca actgagcgcc ggtcgctacc attaccaact tgtctggtgt 1440

caaaaataat aggggccgct gtcatcagag taagtttaaa ctgagttcta ctaactaacg 1500

agtaatattt aaattttcag catctcgcgc ccgtgcctct gacttctaag tccaattact 1560

cttcaacatc cctacatgct ctttctccct gtgctcccac cccctatttt tgttattatc 1620

aaaaaaactt cttcttaatt tctttgtttt ttagcttctt ttaagtcacc tctaacaatg 1680

aaattgtgta gattcaaaaa tagaattaat tcgtaataaa aagtcgaaaa aaattgtgct 1740

ccctcccccc attaataata attctatccc aaaatctaca caatgttctg tgtacacttc 1800

ttatgttttt tttacttctg ataaattttt tttgaaacat catagaaaaa accgcacaca 1860

aaatacctta tcatatgtta cgtttcagtt tatgaccgca atttttattt cttcgcacgt 1920

ctgggcctct catgacgtca aatcatgctc atcgtgaaaa agttttggag tatttttgga 1980

atttttcaat caagtgaaag tttatgaaat taattttcct gcttttgctt tttgggggtt 2040

tcccctattg tttgtcaaga gtttcgagga cggcgttttt cttgctaaaa tcacaagtat 2100

tgatgagcac gatgcaagaa agatcggaag aaggtttggg tttgaggctc agtggaaggt 2160

gagtagaagt tgataatttg aaagtggagt agtgtctatg gggtttttgc cttaaatgac 2220

agaatacatt cccaatatac caaacataac tgtttcctac tagtcggccg tacgggcccg 2280

gtacccagct tttgttccct ttagtgaggg ttaattgcgc gcttggcgta atcatggtca 2340

tagctgtttc ctgtgtgaaa ttgttatccg ctcacaattc cacacaacat acgagccgga 2400

agcataaagt gtaaagcctg gggtgcctaa tgagtgagct aactcacatt aattgcgttg 2460

cgctcactgc ccgctttcca gtcgggaaac ctgtcgtgcc agctgcatta atgaatcggc 2520

caacgcgcgg ggagaggcgg tttgcgtatt gggcgctctt ccgcttcctc gctcactgac 2580

tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa ggcggtaata 2640

cggttatcca cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa 2700

aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt tccataggct ccgcccccct 2760

gacgagcatc acaaaaatcg acgctcaagt cagaggtggc gaaacccgac aggactataa 2820

agataccagg cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg 2880

cttaccggat acctgtccgc ctttctccct tcgggaagcg tggcgctttc tcatagctca 2940

cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa 3000

ccccccgttc agcccgaccg ctgcgcctta tccggtaact atcgtcttga gtccaacccg 3060

gtaagacacg acttatcgcc actggcagca gccactggta acaggattag cagagcgagg 3120

tatgtaggcg gtgctacaga gttcttgaag tggtggccta actacggcta cactagaagg 3180

acagtatttg gtatctgcgc tctgctgaag ccagttacct tcggaaaaag agttggtagc 3240

tcttgatccg gcaaacaaac caccgctggt agcggtggtt tttttgtttg caagcagcag 3300

attacgcgca gaaaaaaagg atctcaagaa gatcctttga tcttttctac ggggtctgac 3360

gctcagtgga acgaaaactc acgttaaggg attttggtca tgagattatc aaaaaggatc 3420

ttcacctaga tccttttaaa ttaaaaatga agttttaaat caatctaaag tatatatgag 3480

taaacttggt ctgacagtta ccaatgctta atcagtgagg cacctatctc agcgatctgt 3540

ctatttcgtt catccatagt tgcctgactc cccgtcgtgt agataactac gatacgggag 3600

ggcttaccat ctggccccag tgctgcaatg ataccgcgag acccacgctc accggctcca 3660

gatttatcag caataaacca gccagccgga agggccgagc gcagaagtgg tcctgcaact 3720

ttatccgcct ccatccagtc tattaattgt tgccgggaag ctagagtaag tagttcgcca 3780

gttaatagtt tgcgcaacgt tgttgccatt gctacaggca tcgtggtgtc acgctcgtcg 3840

tttggtatgg cttcattcag ctccggttcc caacgatcaa ggcgagttac atgatccccc 3900

atgttgtgca aaaaagcggt tagctccttc ggtcctccga tcgttgtcag aagtaagttg 3960

gccgcagtgt tatcactcat ggttatggca gcactgcata attctcttac tgtcatgcca 4020

tccgtaagat gcttttctgt gactggtgag tactcaacca agtcattctg agaatagtgt 4080

atgcggcgac cgagttgctc ttgcccggcg tcaatacggg ataataccgc gccacatagc 4140

agaactttaa aagtgctcat cattggaaaa cgttcttcgg ggcgaaaact ctcaaggatc 4200

ttaccgctgt tgagatccag ttcgatgtaa cccactcgtg cacccaactg atcttcagca 4260

tcttttactt tcaccagcgt ttctgggtga gcaaaaacag gaaggcaaaa tgccgcaaaa 4320

aagggaataa gggcgacacg gaaatgttga atactcatac tcttcctttt tcaatattat 4380

tgaagcattt atcagggtta ttgtctcatg agcggataca tatttgaatg tatttagaaa 4440

aataaacaaa taggggttcc gcgcacattt ccccgaaaag tgccacctaa attgtaagcg 4500

ttaatatttt gttaaaattc gcgttaaatt tttgttaaat cagctcattt tttaaccaat 4560

aggccgaaat cggcaaaatc ccttataaat caaaagaata gaccgagata gggttgagtg 4620

ttgttccagt ttggaacaag agtccactat taaagaacgt ggactccaac gtcaaagggc 4680

gaaaaaccgt ctatcagggc gatggcccac tacgtgaacc atcaccctaa tcaagttttt 4740

tggggtcgag gtgccgtaaa gcactaaatc ggaaccctaa agggagcccc cgatttagag 4800

cttgacgggg aaagccggcg aacgtggcga gaaaggaagg gaagaaagcg aaaggagcgg 4860

gcgctagggc gctggcaagt gtagcggtca cgctgcgcgt aaccaccaca cccgccgcgc 4920

ttaatgcgcc gctacagggc gcgtcccatt cgccattcag gctgcgcaac tgttgggaag 4980

ggcgatcggt gcgggcctct tcgctattac gccagctggc gaaaggggga tgtgctgcaa 5040

ggcgattaag ttgggtaacg ccagggtttt cccagtcacg acgttgtaaa acgacggcca 5100

gtgagcgcgc gtaatacgac tcactatagg gcgaattgga gctccaccgc ggtggcggcc 5160

gctctagaac tagtg 5175



7
12482
DNA
Artificial Sequence

Description of Artificial Sequenceplasmid DNA


7

gatcctccaa aatcgtcttc cgctctgaaa aacgaaagtg gacctttgac atccgaaaaa 60

atgggcgaaa aaatgaaatt gagctttttg ggtcgaaaaa aatgttttta gaatgctgag 120

aacacgttaa acacgaagat catatttatt ttgagacccg gatgctctga aaatgtctga 180

catagattta aaaaagcata tatatatttt tcattttcaa cgtgaaagtt ttgtgcaact 240

ttatagaatc tcctattggc acattgtttt ttatttaact gaggcagttt ttgaacacct 300

ttttgaaact ttgaatctct ttgaagtata ctgtcgaaaa gactgacttg agcgttcgaa 360

atgccagaag aaaactatat ttgaatctcg cgctaaattg agaaatgcaa ccgcgctcca 420

ctggacaatt ggaaaaaaaa tttattcgga ggcgacaacg gtattttcga aattgatttt 480

ctgtgtattt tctcattttt tataaattct tctttgattt atcgttcgtt tgtgagaaat 540

ttaattgtat tcaaactttt ttatagtaag ataccggtgg taccgctagc cgtacgaacc 600

cgggattggc caaaggaccc aaaggtatgt ttcgaatgat actaacataa catagaacat 660

tttcaggagg acccttgctt ggagggtacc ggatgactgc tccaaagaag aagcgtaagc 720

tcatgaacac gattaacatc gctaagaacg acttctctga catcgaactg gctgctatcc 780

cgttcaacac tctggctgac cattacggtg agcgtttagc tcgcgaacag ttggcccttg 840

agcatgagtc ttacgagatg ggtgaagcac gcttccgcaa gatgtttgag cgtcaactta 900

aagctggtga ggttgcggat aacgctgccg ccaagcctct catcactacc ctactcccta 960

agatgattgc acgcatcaac gactggtttg aggaagtgaa agctaagcgc ggcaagcgcc 1020

cgacagcctt ccagttcctg caagaaatca agccggaagc cgtagcgtac atcaccatta 1080

agaccactct ggcttgccta accagtgctg acaatacaac cgttcaggct gtagcaagcg 1140

caatcggtcg ggccattgag gacgaggctc gcttcggtcg tatccgtgac cttgaagcta 1200

agcacttcaa gaaaaacgtt gaggaacaac tcaacaagcg cgtagggcac gtctacaaga 1260

aagcatttat gcaagttgtc gaggctgaca tgctctctaa gggtctactc ggtggcgagg 1320

cgtggtcttc gtggcataag gaagactcta ttcatgtagg agtacgctgc atcgagatgc 1380

tcattgagtc aaccggaatg gttagcttac accgccaaaa tgctggcgta gtaggtcaag 1440

actctgagac tatcgaactc gcacctgaat acgctgaggc tatcgcaacc cgtgcaggtg 1500

cgctggctgg catctctccg atgttccaac cttgcgtagt tcctcctaag ccgtggactg 1560

gcattactgg tggtggctat tgggctaacg gtcgtcgtcc tctggcgctg gtgcgtactc 1620

acagtaagaa agcactgatg cgctacgaag acgtttacat gcctgaggtg tacaaagcga 1680

ttaacattgc gcaaaacacc gcatggaaaa tcaacaagaa agtcctagcg gtcgccaacg 1740

taatcaccaa gtggaagcat tgtccggtcg aggacatccc tgcgattgag cgtgaagaac 1800

tcccgatgaa accggaagac atcgacatga atcctgaggc tctcaccgcg tggaaacgtg 1860

ctgccgctgc tgtgtaccgc aagacaaggc tcgcaagtct cgccgtatca gccttgagtt 1920

catgcttgag caagccaata agtttgctaa ccataaggcc atctggttcc cttacaacat 1980

ggactggcgc ggttcgtgtt tacgctgtgt caatgttcaa cccgcaaggt aacgatatga 2040

ccaaaggacg tcttacgctg gcgaaaggta aaccaatcgg taaggaaggt tactactggc 2100

tgaaaatcca cggtgcaaac tgtgcgggtg tcgataaggt ttcgtttcct gagcgcatca 2160

agttcattga ggaaaaccac gagaacatca tggcttgcgc taagtctcca ctggagaaca 2220

cttggtgggc tgagcaagat tctccgttct gcttccttgc gttctgcttt gagtacgctg 2280

gggtacagca ccacggcctg agctataact gctcccttcc gctggcgttt gacgggtctt 2340

gctctggcat ccagcacttc tccgcgatgc tccgagatga ggtaggtggt cgcgcggtta 2400

acttgcttcc tagtgaaacc gttcaggaca tctacgggat tgttgctaag aaagtcaacg 2460

agattctgca agcagacgca atcaatggga ccgataacga agtagttacc gtgaccgatg 2520

agaacactgg tgaaatctct gagaaagtca agctgggcac taaggcactg gctggtcaat 2580

ggctggctta cggtgttact cgcagtgtga ctaagcgttc agtcatgacg ctggcttacg 2640

ggtccaaaga gttcggcttc cgtcaacaag tgctggaaga taccattcag ccagctattg 2700

attccggcaa gggtctgatg ttcactcagc cgaatcaggc tgctggatac atggctaagc 2760

tgatttggga atccgtgagc gtgacggtgg tagctgcggt tgaagcaatg aactggctta 2820

agtctgctgc taagctgctg gctgctgagg tcaaagataa gaagactgga gagattcttc 2880

gcaagcgttg cgctgtgcat tgggtaactc ctgatggttt ccctgtgtgg caggaataca 2940

agaagcctat tcagacgcgc ttgaacctga tgttcctcgg tcagttccgc ttacagccta 3000

ccattaacac caacaaagat agcgagattg atgcacacaa acaggagtct ggtatcgctc 3060

ctaactttgt acacagccaa gacggtagcc accttcgtaa gactgtagtg tgggcacacg 3120

agaagtacgg aatcgaatct tttgcactga ttcacgactc cttcggtacc attccggctg 3180

acgctgcgaa cctgttcaaa gcagtgcgcg aaactatggt tgacacatat gagtcttgtg 3240

atgtactggc tgatttctac gaccagttcg ctgaccagtt gcacgagtct caattggaca 3300

aaatgccagc acttccggct aaaggtaact tgaacctccg tgacatctta gagtcggact 3360

tcgcgttcgc gtaagggccc tcgtcgagtc ggtcacaatc acctgaaact ccaaaggcag 3420

ccagtgagga acgtgaagaa gaagaaaaag agtcatctga acaggtttga ttttctttct 3480

ggtcaaaaag atgaaattat tgattttcag ccagatactc ccaaaactag cagcgagaag 3540

tctgcaagtc gttcacagtc gcccagagaa tcgcgggaag tgagccaaga ggtatgtttt 3600

tcaaaaatca ataactgatc ataattttta ttgtttggtg aatttaagaa aataatattc 3660

gaaaattcct ctgaattatc aagattgcag tattaatttc gagaaaaatt gagatattca 3720

tagagctatt gtaaattttc ttgatttcag actgaaactt cggaaaatca agagaaaatc 3780

aaagaaaagg atgacgggga tgatcagcct ggcacaccga acagctatag aagccgggaa 3840

acttcaccag ctccaaaaag gtccaaggag accaggtttg tcaaaagctt cctgcgatta 3900

attctcattt caatttttca gagaatcaga gtctcctgaa aaatccccgg ttcgttcaag 3960

atctcccaga aggtcttcag cacgttcccc gtcacgatct cctagacggc gccgagaaag 4020

aagctcagaa agaaagcaat ccgaagagcc agcaccgcta ccagagaaaa agaagaaaga 4080

gccgctggat attctacgaa caagaaccgg aggagcatat attccacccg ccaaacttcg 4140

acttatgcaa caacagatta gtgataagca aagtgaacag tatcagagaa tgaattggga 4200

aagaatgaag aaaaagattc acggattggt taacagagtc aacgcgaaga atcttgttca 4260

aattgtcaga gaacttcttc aagagaatgt gattcgttca aagtgagtga gaaaatcgaa 4320

ggaaaaggaa agaattaatt taatttttca ggggacttct ctgccgtgac attattcaag 4380

ctcaggcttt ctcaccagga ttctctaacg tctatgcagc tttggcggca gttatcaact 4440

cgaaattccc tcatgtcggt gaacttcttc tccgtcgtct gattgtacag ttcaaaagaa 4500

gtttccgtag aaatgacaga ggcgtcacgg tgaacgtgat caaattcatc gcacatttga 4560

ttaatcaaca agttgctcac gaagttcttg cgctggaaat catgattctg atgcttgaag 4620

aaccaactga tgattcagtt gaagtcgcca ttgcgttcct gaaagagtgt ggagcaaagc 4680

ttctggagat tgctccagca gctcttaaca gtgtctacga ccgtcttcgt gcaattctca 4740

tggaaactga aagatcggaa aatgcactgg atcgacgtat tcagtatatg attgagactg 4800

caatgcagat tcgaaaggac aaatttgcgg taaggtagaa tatataaata gtttattaga 4860

aaaaaataaa ttagaataat ttaaattcct actagccaat caggcgacct ttttgcgcat 4920

agttctatta ttgaaaaatt tggagaattt ctcatattct cgctcggaaa tctggaattc 4980

gacgagatct tctggcttct gtgcagctgc atcgctttgt gctccctttc tcgcttgtct 5040

tctgtgtaca ccaagaacct tgttgagttc atcaactgaa tctgtgactg gcttgttgct 5100

cactggatgc actagacgac tgattctcga gaaatcagat tgagttgcga ttagggtgac 5160

ctagaaattg ggaataatac gaacttttga aaatattcag gaggattaaa aaaattattc 5220

tcgacaatcc tacaaattta cttattgcac catgttgctc caacattttt cattaaaagt 5280

taatgaaaaa atgtagaaaa tcggaaattg gcaattttca gaccattttt aagcattttc 5340

aaaaaaaaat tgcagctgaa ataaatgtca ttttcagata aatcgagcga ttttctgttg 5400

tctgacacta gtttttagtt ttaaaaaatg ttggaagaac atggtgcaat aggtaatttc 5460

atagaatttc catgtgtttt ttttcaatta accaattatc caaatcttcc aaactcacat 5520

tttgcggagc tgggctatca agaatctgct gcagttttat aagacgagca tctctgatat 5580

cactgaaaat taatttttaa tcaaaacttg aatatcaact aaacccactt attaactttc 5640

tcgatcttct gtcgttcggt acgatgacgg tgaagaagcc aattgtagta gttgatttgg 5700

ttcaagtcct ttcggtgttg tacgtcagtg tcctgcaatg ctatttagtt ataacttagg 5760

cctaagattc aatttaatga agtgattaaa tttgttctct gaacctctta agatgatctt 5820

ttggattaga aacatataag acaggtttac ctatctatta aaaaacagat caaaatagat 5880

acgaccaaat cggataatcc atgcctacct ggcatctagg aacgtgttct tagaagattt 5940

cttacgtaat cgtatgaaga aataacaatt tgatcgttgg ccagcaaaaa tagggtttta 6000

agtgggatag tgtttttatt agctaaccgg aaaattttat agtttttttt tgcaagaaac 6060

cactgaaaac cccctaattg tatacatttt ttggagcagc ttctggtctt tttgagcaat 6120

aaaattcgat aaaacagaat ttaagtgtaa attgttcaca tttagtttct attttatcaa 6180

attttgttgc tcaaaaacat tcgaagctgc tctaaaaaaa tgcattaaaa aaggggtttt 6240

cagtggtttt tcacattaaa aaagctaatt ttaactaaaa atccatcata tttccaactt 6300

tgtcacaaca ataaaatgct ggtcaaaatg tgttcgaaaa aatgtttttt tttttaattt 6360

ttataattta aaaatagttt tctttcgctg ggacacatac atttttgggc gtaaattttc 6420

agttcaaatt tccattttta caaccataat cataaagcta cgtctgatct ctctcgcact 6480

tacctgcgcc tgattcgaaa gaacaaccgt agccaaaaga acaagaagaa caagcacgta 6540

gttgtggtag tggacgttca tcacgcaata ctgaccaatg gtcgtggggt ctcactttcc 6600

gtactattga gagaggggag actgaagatg gcaattgagg acagtgtctt cgacgcacgc 6660

atgcatccat aagcataatc caggagggat ggagagaaaa atcttgtttc taagcccctc 6720

cctttgtaat acatacacat atctaatacc gaagaatggc taattgaatg gacgtcagct 6780

gttgctgtag ttgccaaggc atcatcgatg aaataactga aagaaagaat taaataatta 6840

ttgcaggcgt atccggcggt cattgaagac ttggacttga ttgaggagga ggatcagatc 6900

atccatacac ttaatttgga ggatgcggtt gatccggaaa atgggcttag taagtgactg 6960

accacacgcg gggggcatta atttaataaa ttgaattcca tttcagatgt gttcaaacta 7020

gatccagaat tcgaaaagaa cgaggaggtt tatgaggaga tccgtaagga aatcattgga 7080

aacgccgata tttcggatga ggatggtggc gacgagttgg atgatgaaga agagggtagt 7140

gatgtggaag aggctccgaa gaagactaca gagattattg ataatactga tcagaattga 7200

ctgctttcag aaggtattca ttttgagttt tgggccggca aatctgtaag ttgccggttg 7260

ccgaaaattt gctgaatttg ccggaaaaaa aaattccgga atttatttaa aaactttttg 7320

taaaaattaa attaaatttg caacttttca gagaagtcta cctgacaatg caatcatctt 7380

tggactacca agaagctgct cacaaattgc tgaaaatgaa gattccagac agcatgcagg 7440

tcagcgatgt tgcaaagaaa aattttcgac caaaaaaacc aaccaatcat aaaatttaaa 7500

aaaaaactcc gtttttttct ttttttttat acgagaaaaa ccaaaaaaat gtatttttgc 7560

caaattctaa aatactatcc ccgaaatttt caatattttc tctttcagaa cgaactctgc 7620

gcgatgcttg tcgattgttg tgctcaacag cgtacctacg agcgattcta cggaatgctc 7680

atcgaacgtt tctgccgact tcgcctcgaa taccagcaat actttgaaaa gctctgccag 7740

gacacgtatt ccacgattca ccgaattgac atcacaaaac tgcggaattt ggctcgcctt 7800

attgctcatt tgctctcgac ggatgctatt gactggaaga ttttggccga tatgaaaatg 7860

accgaagagg acacaacttc ttctggcaga atctatatta aatatatatt taatgaactt 7920

gtggaggcga tgggaatggt taaacttcat tcgagagtta ctgatccgtg agtttcctag 7980

agagagttgt tttcgtattc aattttccct attttcagaa ctttggctca ttgctttgtt 8040

ggattattcc cacgaactaa tccgaacagc gcacgatttt cgatcaactt cttcacaatg 8100

attggattgg gtggtttgac gttggaactt cgtgaatggc tggcaaaggg tctcaagaag 8160

aagaagggaa tgctggatca gttgaaggcc gaatcaagct cagattcatc gtcgtcttcg 8220

gattcgtcag actcgtctga ttcttcggat tctgacgatt catccgactc gtcttcagat 8280

tcctcatctt cttcagaatc agagccagaa ccaccgaaga aaaagaagaa gaagaacagt 8340

gaagagagtt ccaaaaagaa ggaaaaagag aatattggtc gacgggatcg tggagacaag 8400

agagctgaac gtcatcgtga tcaaagtgtg gagaacaagg acaaggatcg tcgacgtcgc 8460

caggattctg acgaaaatcg tcggccagaa cgaggagatg accgcaagga tcggagtaaa 8520

gatcgtcgtc gtcaagactc ggatgatgag gatcggaaag gtcgtgaacg tcgggaagat 8580

tcaggggaaa gacgtcgcgg agatcgggat cgacgtgatc gaaacaagga tcaggaggat 8640

caccgtgaag atcgccgtga ccgaagcaag gatcgtgagg atcgacgtga tcgccgtcgt 8700

catgactctg atgatgatcg taaaactcgt cgggatagaa gtgaagagcg aggaggacgt 8760

cgtcgtgaag tggaatcgga tgatcgacgc cgacgtcgtt gaattttcaa attttaaata 8820

ctgaatattt gttttttttc ctattattta tttattctct ttgtgttttt tttcttgctt 8880

tctaaaaaat taattcaatc caaatctaaa catgagcggt tttttttctc tttccgtctc 8940

ccaattcgta ttccgctcct ctcatctgaa cacaatgtgc aagtttattt atcttctcgc 9000

tttcatttca ttaggacgtg gggggaattg gtggaagggg gaaacacaca aaaggatgat 9060

ggaaatgaaa taaggacaca caatatgcaa caacattcaa ttcagaaata tggaggaagg 9120

tttaaaagaa aacataaaaa tatatagagg aggaaggaaa actagtaaaa aataagcaaa 9180

gaaattaggc gaacgatgag aattgtcctc gcttggcaaa tgcgaatccg tatggagagg 9240

cacgtttggc gaaggcaaat gttcggtatg gagatctgta aaaattttta agttgaaatt 9300

tggtgttgct cttttacaaa attttccgat tttcgcttga aattacggtg ccaggtctcg 9360

acacgtcttc caatttttca aattcaaaag agcctttaat gggctgtagt tgctaatttc 9420

tcgtttttga aaatttttct tccgtttaat cgaaatttga tgtattttat ttatgatttt 9480

caataaattt caaagaaact ggtgaaaact cggaaaattg tgaactacag taatccaatc 9540

cttaaaggcg cacacctttt aaatgtccgc cccaatacga tattttttta agattcgcta 9600

gagcggccgc caccgcggtg gagctccaat tcgccctata gtgagtcgta ttacaattca 9660

ctggccgtcg ttttacaacg tcgtgactgg gaaaaccctg gcgttaccca acttaatcgc 9720

cttgcagcac atcccccctt cgccagctgg cgtaatagcg aagaggcccg caccgatcgc 9780

ccttcccaac agttgcgtag cctgaatggc gaatgggacg cgccctgtag cggcgcatta 9840

agcgcggcgg gtgtggtggt tacgcgcagc gtgaccgcta cacttgccag cgccctagcg 9900

cccgctcctt tcgctttctt cccttccttt ctcgccacgt tcgccggctt tccccgtcaa 9960

gctctaaatc gggggctccc tttagggttc cgatttagtg ctttacggca cctcgacccc 10020

aaaaaacttg attagggtga tggttcacgt agtgggccat cgccctgata gacggttttt 10080

cgccctttga cgttggagtc cacgttcttt aatagtggac tcttgttcca aactggaaca 10140

acactcaacc ctatctcggt ctattctttt gatttataag ggattttgcc gatttcggcc 10200

tattggttaa aaaatgagct gatttaacaa aaatttaacg cgaattttaa caaaatatta 10260

acgtttacaa tttcaggtgg cacttttcgg ggaaatgtgc gcggaacccc tatttgttta 10320

tttttctaaa tacattcaaa tatgtatccg ctcatgagac aataaccctg ataaatgctt 10380

caataatatt gaaaaaggaa gagtatgagt attcaacatt tccgtgtcgc ccttattccc 10440

ttttttgcgg cattttgcct tcctgttttt gctcacccag aaacgctggt gaaagtaaaa 10500

gatgctgaag atcagttggg tgcacgagtg ggttacatcg aactggatct caacagcggt 10560

aagatccttg agagttttcg ccccgaagaa cgttttccaa tgatgagcac ttttaaagtt 10620

ctgctatgtg gcgcggtatt atcccgtatt gacgccgggc aagagcaact cggtcgccgc 10680

atacactatt ctcagaatga cttggttgag tactcaccag tcacagaaaa gcatcttacg 10740

gatggcatga cagtaagaga attatgcagt gctgccataa gcatgagtga taacactgcg 10800

gccaacttac ttctgacaac gatcggagga ccgaaggagc taaccgcttt ttttcacaac 10860

atgggggatc atgtaactcg ccttgatcgt tgggaaccgg agctgaatga agccatacca 10920

aacgacgagc gtgacaccac gatgcctgta gcaatggcaa caacgttgcg caaactatta 10980

actggcgaac tacttactct agcttcccgg caacaattaa tagactggat ggaggcggat 11040

aaagttgcag gaccacttct gcgctcggcc cttccggctg gctggtttat tgctgataaa 11100

tctggagccg gtgagcgtgg gtctcgcggt atcattgcag cactggggcc agatggtaag 11160

ccctcccgta tcgtagttat ctacacgacg ggcagtcagg caactatgga tgaacgaaat 11220

agacagatcg ctgagatagg tgcctcactg attaagcatt ggtaactgtc agaccaagtt 11280

tactcatata tactttagat tgatttaaaa cttcattttt aatttaaaag gatctaggtg 11340

aagatccttt ttgataatct catgaccaaa atcccttaac gtgagttttc gttccactga 11400

gcgtcagacc ccgtagaaaa gatcaaagga tcttcttgag atcctttttt tctgcgcgta 11460

atctgctgct tgcaaacaaa aaaaccaccg ctaccagcgg tggtttgttt gccggatcaa 11520

gagctaccaa ctctttttcc gaaggtaact ggcttcagca gagcgcagat accaaatact 11580

gtccttctag tgtagccgta gttaggccac cacttcaaga actctgtagc accgcctaca 11640

tacctcgctc tgctaatcct gttaccagtg gctgctgcca gtggcgataa gtcgtgtctt 11700

accgggttgg actcaagacg atagttaccg gataaggcgc agcggtcggg ctgaacgggg 11760

ggttcgtgca cacagcccag cttggagcga acgacctaca ccgaactgag atacctacag 11820

cgtgagcatt gagaaagcgc cacgcttccc gaagggagaa aggcggacag gtatccggta 11880

agcggcaggg tcggaacagg agagcgcacg agggagcttc caggggggaa cgcctggtat 11940

ctttatagtc ctgtcgggtt tcgccacctc tgacttgagc gtcgattttt gtgatgctcg 12000

tcaggggggc cgagcctatg gaaaaacgcc agcaacgcgg cctttttacg gttcctggcc 12060

ttttgctggc cttttgctca catgttcttt cctgcgttat cccctgattc tgtggataac 12120

cgtattaccg cctttgagtg agctgatacc gctcgccgca gccgaacgac cgagcgcagc 12180

gagtcagtga gcgaggaagc ggaagagcgc ccaatacgca aaccgcctct ccccgcgcgt 12240

tggccgattc attaatgcag ctggcacgac aggtttcccg actggaaagc gggcagtgag 12300

cgcaacgcaa ttaatgtgag ttacctcact cattaggcac cccaggcttt acactttatg 12360

cttccggctc ctatgttgtg tggaattgtg agcggataac aatttcacac aggaaacagc 12420

tatgaccatg attacgccaa gctcggaatt aaccctcact aaagggaaca aaagctgggg 12480

gg 12482



8
7209
DNA
Artificial Sequence

Description of Artificial Sequenceplasmid DNA


8

gatccgtcga cagatctccc tatagtgagt cgtattactg cagccaagct aattccgggc 60

gaatttctta tgatttatga tttttattat taaataagtt ataaaaaaaa taagtgtata 120

caaattttaa agtgactctt aggttttaaa acgaaaattc ttgttcttga gtaactcttt 180

cctgtaggtc aggttgcttt ctcaggtata gcatgaggtc gctcttattg accacacctc 240

taccggcatg caagcttggc gtaatcatgg tcatagctgt ttcctgtgtg aaattgttat 300

ccgctcacaa ttccacacaa catacgagcc ggaagcataa agtgtaaagc ctggggtgcc 360

taatgagtga ggtaactcac attaattgcg ttgcgctcac tgcccgcttt ccagtcggga 420

aacctgtcgt gccagctgga ttaatgaatc ggccaacgcg cggggagagg cggtttgcgt 480

attgggcgct cttccgcttc ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg 540

cgagcggtat cagctcactc aaaggcggta atacggttat ccacagaatc aggggataac 600

gcaggaaaga acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg 660

ttgctggcgt ttttccatag gctccgcccc cctgacgagc atcacaaaaa tcgacgctca 720

agtcagaggt ggcgaaaccc gacaggacta taaagatacc aggcgtttcc ccctggaagc 780

tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg gatacctgtc cgcctttctc 840

ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta ggtatctcag ttcggtgtag 900

gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc 960

ttatccggta actatcgtct tgagtccaac ccggtaagac acgacttatc gccactggca 1020

gcagccactg gtaacaggat tagcagagcg aggtatgtag gcggtgctac agagttcttg 1080

aagtggtggc ctaactacgg ctacactaga aggacagtat ttggtatctg cgctctgctg 1140

aagccagtta ccttcggaaa aagagttggt agctcttgat ccggcaaaca aaccaccgct 1200

ggtagcggtg gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa 1260

gaagatcctt tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa 1320

gggattttgg tcatgagatt atcaaaaagg atcttcacct agatcctttt aaattaaaaa 1380

tgaagtttta aatcaatcta aagtatatat gagtaaactt ggtctgacag ttaccaatgc 1440

ttaatcagtg aggcacctat ctcagcgatc tgtctatttc gttcatccat agttgcctga 1500

ctccccgtcg tgtagataac tacgatacgg gagggcttac catctggccc cagtgctgca 1560

atgataccgc gagacccacg ctcaccggct ccagatttat cagcaataaa ccagccagcc 1620

ggaagggccg agcgcagaag tggtcctgca actttatccg cctccatcca gtctattaat 1680

tgttgccggg aagctagagt aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc 1740

attgctacag gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt cagctccggt 1800

tcccaacgat caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc 1860

ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag tgttatcact catggttatg 1920

gcagcactgc ataattctct tactgtcatg ccatccgtaa gatgcttttc tgtgactggt 1980

gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg 2040

gcgtcaatac gggataatac cgcgccacat agcagaactt taaaagtgct catcattgga 2100

aaacgttctt cggggcgaaa actctcaagg atcttaccgc tgttgagatc cagttcgatg 2160

taacccactc gtgcacccaa ctgatcttca gcatctttta ctttcaccag cgtttctggg 2220

tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa taagggcgac acggaaatgt 2280

tgaatactca tactcttcct ttttcaatat tattgaagca tttatcaggg ttattgtctc 2340

atgagcggat acatatttga atgtatttag aaaaataaac aaataggggt tccgcgcaca 2400

tttccccgaa aagtgccacc tgaacgaagc atctgtgctt cattttgtag aacaaaaatg 2460

caacgcgaga gcgctaattt ttcaaacaaa gaatctgagc tgcattttta cagaacagaa 2520

atgcaacgcg aaagcgctat tttaccaacg aagaatctgt gcttcatttt tgtaaaacaa 2580

aaatgcaacg cgagagcgct aatttttcaa acaaagaatc tgagctgcat ttttacagaa 2640

cagaaatgca acgcgagagc gctattttac caacaaagaa tctatacttc ttttttgttc 2700

tacaaaaatg catcccgaga gcgctatttt tctaacaaag catcttagat tacttttttt 2760

ctcctttgtg cgctctataa tgcagtctct tgataacttt ttgcactgta ggtccgttaa 2820

ggttagaaga aggctacttt ggtgtctatt ttctcttcca taaaaaaagc ctgactccac 2880

ttcccgcgtt tactgattac tagcgaagct gcgggtgcat tttttcaaga taaaggcatc 2940

cccgattata ttctataccg atgtggattg cgcatacttt gtgaacagaa agtgatagcg 3000

ttgatgattc ttcattggtc agaaaattat gaacggtttc ttctattttg tctctatata 3060

ctacgtatag gaaatgttta cattttcgta ttgttttcga ttcactctat gaatagttct 3120

tactacaatt tttttgtcta aagagtaata ctagagataa acataaaaaa tgtagaggtc 3180

gagtttagat gcaagttcaa ggagcgaaag gtggatgggt aggttatata gggatatagc 3240

acagagatat atagcaaaga gatacttttg agcaatgttt gtggaagcgg tattcgcaat 3300

attttagtag ctcgttacag tccggtgcgt ttttggtttt ttgaaagtgc gtcttcagag 3360

cgcttttggt tttcaaaagc gctctgaagt tcctatactt tctagagaat aggaacttcg 3420

gaataggaac ttcaaagcgt ttccgaaaac gagcgcttcc gaaaatgcaa cgcgagctgc 3480

gcacatacag ctcactgttc acgtcgcacc tatatctgcg tgttgcctgt atatatatat 3540

acatgagaag aacggcatag tgcgtgttta tgcttaaatg cgtacttata tgcgtctatt 3600

tatgtaggat gaaaggtagt ctagtacctc ctgtgatatt atcccattcc atgcggggta 3660

tcgtatgctt ccttcagcac taccctttag ctgttctata tgctgccact cctcaattgg 3720

attagtctca tccttcaatg ctatcatttc ctttgatatt ggatcatatt aagaaaccat 3780

tattatcatg acattaacct ataaaaatag gcgtatcacg aggccctttc gtctcgcgcg 3840

tttcggtgat gacggtgaaa acctctgaca catgcagctc ccggagacgg tcacagcttg 3900

tctgtaagcg gatgccggga gcagacaagc ccgtcagggc gcgtcagcgg gtgttggcgg 3960

gtgtcggggc tggcttaact atgcggcatc agagcagatt gtactgagag tgcaccatag 4020

atcaacgaca ttactatata tataatatag gaagcattta atagacagca tcgtaatata 4080

tgtgtacttt gcagttatga cgccagatgg cagtagtgga agatattctt tattgaaaaa 4140

tagcttgtca ccttacgtac aatcttgatc cggagctttt ctttttttgc cgattaagaa 4200

ttaattcggt cgaaaaaaga aaaggagagg gccaagaggg agggcattgg tgactattga 4260

gcacgtgagt atacgtgatt aagcacacaa aggcagcttg gagtatgtct gttattaatt 4320

tcacaggtag ttctggtcca ttggtgaaag tttgcggctt gcagagcaca gaggccgcag 4380

aatgtgctct agattccgat gctgacttgc tgggtattat atgtgtgccc aatagaaaga 4440

gaacaattga cccggttatt gcaaggaaaa tttcaagtct tgtaaaagca tataaaaata 4500

gttcaggcac tccgaaatac ttggttggcg tgtttcgtaa tcaacctaag gaggatgttt 4560

tggctctggt caatgattac ggcattgata tcgtccaact gcatggagat gagtcgtggc 4620

aagaatacca agagttcctc ggtttgccag ttattaaaag actcgtattt ccaaaagact 4680

gcaacatact actcagtgca gcttcacaga aacctcattc gtttattccc ttgtttgatt 4740

cagaagcagg tgggacaggt gaacttttgg attggaactc gatttctgac tgggttggaa 4800

ggcaagagag ccccgaaagc ttacatttta tgttagctgg tggactgacg ccagaaaatg 4860

ttggtgatgc gcttagatta aatggcgtta ttggtgttga tgtaagcgga ggtgtggaga 4920

caaatggtgt aaaagactct aacaaaatag caaatttcgt caaaaatgct aagaaatagg 4980

ttattactga gtagtattta tttaagtatt gtttgtgcac ttgccgatct atgcggtgtg 5040

aaataccgca cagatgcgta aggagaaaat accgcatcag gaaattgtaa acgttaatat 5100

tttgttaaaa ttcgcgttaa atttttgtta aatcagctca ttttttaacc aataggccga 5160

aatcggcaaa atcccttata aatcaaaaga atagaccgag atagggttga gtgttgttcc 5220

agtttggaac aagagtccac tattaaagaa cgtggactcc aacgtcaaag ggcgaaaaac 5280

cgtctatcag ggcgatggcc cactacgtga accatcaccc taatcaagtt ttttggggtc 5340

gaggtgccgt aaagcactaa atcggaaccc taaagggagc ccccgattta gagcttgacg 5400

gggaaagccg gcgaacgtgg cgagaaagga agggaagaaa gcgaaaggag cgggcgctag 5460

ggcgctggca agtgtagcgg tcacgctgcg cgtaaccacc acacccgccg cgcttaatgc 5520

gccgctacag ggcgcgtcgc gccattcgcc attcaggctg cgcaactgtt gggaagggcg 5580

atcggtgcgg gcctcttcgc tattacgcca gctggcgaaa gggggatgtg ctgcaaggcg 5640

attaagttgg gtaacgccag ggttttccca gtcacgacgt tgtaaaacga cggccagtcg 5700

tccaagcttt cgcgagctcg agatcccgag ctttgcaaat taaagccttc gagcgtccca 5760

aaaccttctc aagcaaggtt ttcagtataa tgttacatgc gtacacgcgt ctgtacagaa 5820

aaaaaagaaa aatttgaaat ataaataacg ttcttaatac taacataact ataaaaaaat 5880

aaatagggac ctagacttca ggttgtctaa ctccttcctt ttcggttaga gcggatgtgg 5940

ggggagggcg tgaatgtaag cgtgacataa ctaattacat gatatccttt tgttgtttcc 6000

gggtgtacaa tatggacttc ctcttttctg gcaaccaaac ccatacatcg ggattcctat 6060

aataccttcg ttggtctccc taacatgtag gtggcggagg ggagatatac aatagaacag 6120

ataccagaca agacataatg ggctaaacaa gactacacca attacactgc ctcattgatg 6180

gtggtacata acgaactaat actgtagccc tagacttgat agccatcatc atatcgaagt 6240

ttcactaccc tttttccatt tgccatctat tgaagtaata ataggcgcat gcaacttctt 6300

ttcttttttt ttcttttctc tctcccccgt tgttgtctca ccatatccgc aatgacaaaa 6360

aaaatgatgg aagacactaa aggaaaaaat taacgacaaa gacagcacca acagatgtcg 6420

ttgttccaga gctgatgagg ggtatcttcg aacacacgaa actttttcct tccttcattc 6480

acgcacacta ctctctaatg agcaacggta tacggccttc cttccagtta cttgaatttg 6540

aaataaaaaa agtttgccgc tttgctatca agtataaata gacctgcaat tattaatctt 6600

ttgtttcctc gtcattgttc tcgttccctt tcttccttgt ttctttttct gcacaatatt 6660

tcaagctata ccaagcatac aatcaactcc aagcttgaag caagcctcct gaaagatgaa 6720

gctactgtct tctatcgaac aagcatgcga tatttgccga cttaaaaagc tcaagtgctc 6780

caaagaaaaa ccgaagtgcg ccaagtgtct gaagaacaac tgggagtgtc gctactctcc 6840

caaaaccaaa aggtctccgc tgactagggc acatctgaca gaagtggaat caaggctaga 6900

aagactggaa cagctatttc tactgatttt tcctcgagaa gaccttgaca tgattttgaa 6960

aatggattct ttacaggata taaaagcatt gttaacagga ttatttgtac aagataatgt 7020

gaataaagat gccgtcacag atagattggc ttcagtggag actgatatgc ctctaacatt 7080

gagacagcat agaataagtg cgacatcatc atcggaagag agtagtaaca aaggtcaaag 7140

acagttgact gtatcgccgg aattcttaat acgactcact atagggcata tggccatgga 7200

ggccccggg 7209



9
6820
DNA
Artificial Sequence

Description of Artificial Sequenceplasmid DNA


9

gatccgtcga cagatctccc tatagtgagt cgtattactg cagagatcta tgaatcgtag 60

atactgaaaa accccgcaag ttcacttcaa ctgtgcatcg tgcaccatct caatttcttt 120

catttataca tcgttttgcc ttcttttatg taactatact cctctaagtt tcaatcttgg 180

ccatgtaacc tctgatctat agaatttttt aaatgactag aattaatgcc catctttttt 240

ttggacctaa attcttcatg aaaatatatt acgagggctt attcagaagc tttggacttc 300

ttcgccagag gtttggtcaa gtctccaatc aaggttgtcg gcttgtctac cttgccagaa 360

atttacgaaa agatggaaaa gggtcaaatc gttggtagat acgttgttga cacttctaaa 420

taagcgaatt tcttatgatt tatgattttt attattaaat aagttataaa aaaaataagt 480

gtatacaaat tttaaagtga ctcttaggtt ttaaaacgaa aattcttgtt cttgagtaac 540

tctttcctgt aggtcaggtt gctttctcag gtatagcatg aggtcgctct tattgaccac 600

acctctaccg gcatgcccga aattccccta ccctatgaac atattccatt ttgtaatttc 660

gtgtcgtttc tattatgaat ttcatttata aagtttatgt acaaatatca taaaaaaaga 720

gaatcttttt aagcaaggat tttcttaact tcttcggcga cagcatcacc gacttcggtg 780

gtactgttgg aaccacctaa atcaccagtt ctgatacctg catccaaaac ctttttaact 840

gcatcttcaa tggccttacc ttcttcaggc aagttcaatg acaatttcaa catcattgca 900

gcagacaaga tagtggcgat agggtcaacc ttattctttg gcaaatctgg agcagaaccg 960

tggcatggtt cgtacaaacc aaatgcggtg ttcttgtctg gcaaagaggc caaggacgca 1020

gatggcaaca aacccaagga acctgggata acggaggctt catcggagat gatatcacca 1080

aacatgttgc tggtgattat aataccattt aggtgggttg ggttcttaac taggatcatg 1140

gcggcagaat caatcaattg atgttgaacc ttcaatgtag gaaattcgtt cttgatggtt 1200

tcctccacag tttttctcca taatcttgaa gaggccaaaa cattagcttt atccaaggac 1260

caaataggca atggtggctc atgttgtagg gccatgaaag cggccattct tgtgattctt 1320

tgcacttctg gaacggtgta ttgttcacta tcccaagcga caccatcacc atcgtcttcc 1380

tttctcttac caaagtaaat acctcccact aattctctga caacaacgaa gtcagtacct 1440

ttagcaaatt gtggcttgat tggagataag tctaaaagag agtcggatgc aaagttacat 1500

ggtcttaagt tggcgtacaa ttgaagttct ttacggattt ttagtaaacc ttgttcaggt 1560

ctaacactac ctgtacccca tttaggacca cccacagcac ctaacaaaac ggcatcaacc 1620

ttcttggagg cttccagcgc ctcatctgga agtgggacac ctgtagcatc gatagcagca 1680

ccaccaatta aatgattttc gaaatcgaac ttgacattgg aacgaacatc agaaatagct 1740

ttaagaacct taatggcttc ggctgtgatt tcttgaccaa cgtggtcacc tggcaaaacg 1800

acgatcttct taggggcaga cattagaatg gtatatcctt gaaatatata tatatattgc 1860

tgaaatgtaa aaggtaagaa aagttagaaa gtaagacgat tgctaaccac ctattggaaa 1920

aaacaatagg tccttaaata atattgtcaa cttcaagtat tgtgatgcaa gcatttagtc 1980

atgaacgctt ctctattcta tatgaaaagc cggttccggc ctctcacctt tcctttttct 2040

cccaattttt cagttgaaaa aggtatatgc gtcaggcgac ctctgaaatt aacaaaaaat 2100

ttccagtcat cgaatttgat tctgtgcgat agcgcccctg tgtgttctcg ttatgttgag 2160

gaaaaaaata atggttgcta agagattcga actcttgcat cttacgatac ctgagtattc 2220

ccacagttgg ggatctcgac tctagctaga ggatcaattc gtaatcatgg tcatagctgt 2280

ttcctgtgtg aaattgttat ccgctcacaa ttccacacaa catacgagcc ggaagcataa 2340

agtgtaaagc ctggggtgcc taatgagtga ggtaactcac attaattgcg ttgcgctcac 2400

tgcccgcttt ccagtcggga aacctgtcgt gccagctgga ttaatgaatc ggccaacgcg 2460

cggggagagg cggtttgcgt attgggcgct cttccgcttc ctcgctcact gactcgctgc 2520

gctcggtcgt tcggctgcgg cgagcggtat cagctcactc aaaggcggta atacggttat 2580

ccacagaatc aggggataac gcaggaaaga acatgtgagc aaaaggccag caaaaggcca 2640

ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag gctccgcccc cctgacgagc 2700

atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta taaagatacc 2760

aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg 2820

gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta 2880

ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg 2940

ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac ccggtaagac 3000

acgacttatc gccactggca gcagccactg gtaacaggat tagcagagcg aggtatgtag 3060

gcggtgctac agagttcttg aagtggtggc ctaactacgg ctacactaga aggacagtat 3120

ttggtatctg cgctctgctg aagccagtta ccttcggaaa aagagttggt agctcttgat 3180

ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag cagattacgc 3240

gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc tacggggtct gacgctcagt 3300

ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt atcaaaaagg atcttcacct 3360

agatcctttt aaattaaaaa tgaagtttta aatcaatcta aagtatatat gagtaaactt 3420

ggtctgacag ttaccaatgc ttaatcagtg aggcacctat ctcagcgatc tgtctatttc 3480

gttcatccat agttgcctga ctccccgtcg tgtagataac tacgatacgg gagggcttac 3540

catctggccc cagtgctgca atgataccgc gagacccacg ctcaccggct ccagatttat 3600

cagcaataaa ccagccagcc ggaagggccg agcgcagaag tggtcctgca actttatccg 3660

cctccatcca gtctattaat tgttgccggg aagctagagt aagtagttcg ccagttaata 3720

gtttgcgcaa cgttgttgcc attgctacag gcatcgtggt gtcacgctcg tcgtttggta 3780

tggcttcatt cagctccggt tcccaacgat caaggcgagt tacatgatcc cccatgttgt 3840

gcaaaaaagc ggttagctcc ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag 3900

tgttatcact catggttatg gcagcactgc ataattctct tactgtcatg ccatccgtaa 3960

gatgcttttc tgtgactggt gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc 4020

gaccgagttg ctcttgcccg gcgtcaatac gggataatac cgcgccacat agcagaactt 4080

taaaagtgct catcattgga aaacgttctt cggggcgaaa actctcaagg atcttaccgc 4140

tgttgagatc cagttcgatg taacccactc gtgcacccaa ctgatcttca gcatctttta 4200

ctttcaccag cgtttctggg tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa 4260

taagggcgac acggaaatgt tgaatactca tactcttcct ttttcaatat tattgaagca 4320

tttatcaggg ttattgtctc atgagcggat acatatttga atgtatttag aaaaataaac 4380

aaataggggt tccgcgcaca tttccccgaa aagtgccacc tgacgtctaa gaaaccatta 4440

ttatcatgac attaacctat aaaaataggc gtatcacgag gccctttcgt ctcgcgcgtt 4500

tcggtgatga cggtgaaaac ctctgacaca tgcagctccc ggagacggtc acagcttgtc 4560

tgtaagcgga tgccgggagc agacaagccc gtcagggcgc gtcagcgggt gttggcgggt 4620

gtcggggctg gcttaactat gcggcatcag agcagattgt actgagagtg caccataacg 4680

catttaagca taaacacgca ctatgccgtt cttctcatgt atatatatat acaggcaaca 4740

cgcagatata ggtgcgacgt gaacagtgag ctgtatgtgc gcagctcgcg ttgcattttc 4800

ggaagcgctc gttttcggaa acgctttgaa gttcctattc cgaagttcct attctctagc 4860

tagaaagtat aggaacttca gagcgctttt gaaaaccaaa agcgctctga agacgcactt 4920

tcaaaaaacc aaaaacgcac cggactgtaa cgagctacta aaatattgcg aataccgctt 4980

ccacaaacat tgctcaaaag tatctctttg ctatatatct ctgtgctata tccctatata 5040

acctacccat ccacctttcg ctccttgaac ttgcatctaa actcgacctc tacatttttt 5100

atgtttatct ctagtattac tctttagaca aaaaaattgt agtaagaact attcatagag 5160

tgaatcgaaa acaatacgaa aatgtaaaca tttcctatac gtagtatata gagacaaaat 5220

agaagaaacc gttcataatt ttctgaccaa tgaagaatca tcaacgctat cactttctgt 5280

tcacaaagta tgcgcaatcc acatcggtat agaatataat cggggatgcc tttatcttga 5340

aaaaatgcac ccgcagcttc gctagtaatc agtaaacgcg ggaagtggag tcaggctttt 5400

tttatggaag agaaaataga caccaaagta gccttcttct aaccttaacg gacctacagt 5460

gcaaaaagtt atcaagagac tgcattatag agcgcacaaa ggagaaaaaa agtaatctaa 5520

gatgctttgt tagaaaaata gcgctctcgg gatgcatttt tgtagaacaa aaaagaagta 5580

tagattcttt gttggtaaaa tagcgctctc gcgttgcatt tctgttctgt aaaaatgcag 5640

ctcagattct ttgtttgaaa aattagcgct ctcgcgttgc atttttgttt tacaaaaatg 5700

aagcacagat tcttcgttgg taaaatagcg ctttcgcgtt gcatttctgt tctgtaaaaa 5760

tgcagctcag attctttgtt tgaaaaatta gcgctctcgc gttgcatttt tgttctacaa 5820

aatgaagcac agatgcttcg ttgcttgcat gcaacttctt ttcttttttt ttcttttctc 5880

tctcccccgt tgttgtctca ccatatccgc aatgacaaaa aaaatgatgg aagacactaa 5940

aggaaaaaat taacgacaaa gacagcacca acagatgtcg ttgttccaga gctgatgagg 6000

ggtatcttcg aacacacgaa actttttcct tccttcattc acgcacacta ctctctaatg 6060

agcaacggta tacggccttc cttccagtta cttgaatttg aaataaaaaa agtttgccgc 6120

tttgctatca agtataaata gacctgcaat tattaatctt ttgtttcctc gtcattgttc 6180

tcgttccctt tcttccttgt ttctttttct gcacaatatt tcaagctata ccaagcatac 6240

aatcaactcc aagctttgca aagatggata aagcggaatt aattcccgag cctccaaaaa 6300

agaagagaaa ggtcgaattg ggtaccgccg ccaattttaa tcaaagtggg aatattgctg 6360

atagctcatt gtccttcact ttcactaaca gtagcaacgg tccgaacctc ataacaactc 6420

aaacaaattc tcaagcgctt tcacaaccaa ttgcctcctc taacgttcat gataacttca 6480

tgaataatga aatcacggct agtaaaattg atgatggtaa taattcaaaa ccactgtcac 6540

ctggttggac ggaccaaact gcgtataacg cgtttggaat cactacaggg atgtttaata 6600

ccactacaat ggatgatgta tataactatc tattcgatga tgaagatacc ccaccaaacc 6660

caaaaaaaga gatcgaattc ttaatacgac tcactatagg gcccatggac gaagaatcca 6720

gttcattctt atgtacctat gctgagaatc gtgccaataa gaagccaata cttccttaga 6780

tgatgcaata aatattaaaa taaaacaaaa cagaaggctg 6820



10
10597
DNA
Artificial Sequence

Description of Artificial Sequenceplasmid DNA


10

ccggtggtac cgggcccccc ctcgaggtcg acggtatcga taagctttcg tcattgaaaa 60

gaaggataag aatggacgat gggaagaagc tctcgttgtt ccaggagatc agaaaacagc 120

aactgttcca aatcttaagg agggagaaga atatcaattc agaatttctg ctcgtaacaa 180

ggctggaact ggagatcctt ctgatccttc tgatcgtgtt gttgcgaagc caagaaacct 240

tgctccaaga attcatcgtg aagatctttc tgatacaact gtcaaggtcg gagccactct 300

caagttcatt gttcatattg atggtgagcc agcaccagat gtaacatggt cattcaatgg 360

aaaaggaatc ggagagagca aggctcaaat tgaaaatgag ccatacatct cgagatttgc 420

tttgccaaag gcacttcgta agcaaagtgg aaaatatacc atcactgcaa ccaacattaa 480

tggaactgac agtgtcacta tcaatatcaa ggtaaaaagc aagccaacga aaccaaaggg 540

accaatcgag gtaactgatg tcttcgaaga tcgtgcaact cttgactgga aaccaccaga 600

ggatgacgga ggagagccaa ttgagttcta tgaaattgaa aagatgaaca ccaaggacgg 660

aatctgggtt ccatgtggac gtagtggaga tacccacttc acagtcgatt cactcaacaa 720

gggagatcat tacaagttcc gtgtcaaggc tgtcaacagc gaaggacctt ctgatccatt 780

ggaaactgaa accgatattt tggctaaaaa tccatttgat cgtccagata gaccaggtcg 840

tccagagcca actgattggg attctgatca tgttgatctc aagtgggatc cactagttct 900

agaagcgctg ctaagggggc cctcgtcgag tcggtcacaa tcacctgaaa ctccaaaggc 960

agccagtgag gaacgtgaag aagaagaaaa agagtcatct gaacaggttt gattttcttt 1020

ctggtcaaaa agatgaaatt attgattttc agccagatac tcccaaaact agcagcgaga 1080

agtctgcaag tcgttcacag tcgcccagag aatcgcggga agtgagccaa gaggtatgtt 1140

tttcaaaaat caataactga tcataatttt tattgtttgg tgaatttaag aaaataatat 1200

tcgaaaattc ctctgaatta tcaagattgc agtattaatt tcgagaaaaa ttgagatatt 1260

catagagcta ttgtaaattt tcttgatttc agactgaaac ttcggaaaat caagagaaaa 1320

tcaaagaaaa ggatgacggg gatgatcagc ctggcacacc gaacagctat agaagccggg 1380

aaacttcacc agctccaaaa aggtccaagg agaccaggtt tgtcaaaagc ttcctgcgat 1440

taattctcat ttcaattttt cagagaatca gagtctcctg aaaaatcccc ggttcgttca 1500

agatctccca gaaggtcttc agcacgttcc ccgtcacgat ctcctagacg gcgccgagaa 1560

agaagctcag aaagaaagca atccgaagag ccagcaccgc taccagagaa aaagaagaaa 1620

gagccgctgg atattctacg aacaagaacc ggaggagcat atattccacc cgccaaactt 1680

cgacttatgc aacaacagat tagtgataag caaagtgaac agtatcagag aatgaattgg 1740

gaaagaatga agaaaaagat tcacggattg gttaacagag tcaacgcgaa gaatcttgtt 1800

caaattgtca gagaacttct tcaagagaat gtgattcgtt caaagtgagt gagaaaatcg 1860

aaggaaaagg aaagaattaa tttaattttt caggggactt ctctgccgtg acattattca 1920

agctcaggct ttctcaccag gattctctaa cgtctatgca gctttggcgg cagttatcaa 1980

ctcgaaattc cctcatgtcg gtgaacttct tctccgtcgt ctgattgtac agttcaaaag 2040

aagtttccgt agaaatgaca gaggcgtcac ggtgaacgtg atcaaattca tcgcacattt 2100

gattaatcaa caagttgctc acgaagttct tgcgctggaa atcatgattc tgatgcttga 2160

agaaccaact gatgattcag ttgaagtcgc cattgcgttc ctgaaagagt gtggagcaaa 2220

gcttctggag attgctccag cagctcttaa cagtgtctac gaccgtcttc gtgcaattct 2280

catggaaact gaaagatcgg aaaatgcact ggatcgacgt attcagtata tgattgagac 2340

tgcaatgcag attcgaaagg acaaatttgc ggtaaggtag aatatataaa tagtttatta 2400

gaaaaaaata aattagaata atttaaattc ctactagcca atcaggcgac ctttttgcgc 2460

atagttctat tattgaaaaa tttggagaat ttctcatatt ctcgctcgga aatctggaat 2520

tcgacgagat cttctggctt ctgtgcagct gcatcgcttt gtgctccctt tctcgcttgt 2580

cttctgtgta caccaagaac cttgttgagt tcatcaactg aatctgtgac tggcttgttg 2640

ctcactggat gcactagacg actgattctc gagaaatcag attgagttgc gattagggtg 2700

acctagaaat tgggaataat acgaactttt gaaaatattc aggaggatta aaaaaattat 2760

tctcgacaat cctacaaatt tacttattgc accatgttgc tccaacattt ttcattaaaa 2820

gttaatgaaa aaatgtagaa aatcggaaat tggcaatttt cagaccattt ttaagcattt 2880

tcaaaaaaaa attgcagctg aaataaatgt cattttcaga taaatcgagc gattttctgt 2940

tgtctgacac tagtttttag ttttaaaaaa tgttggaaga acatggtgca ataggtaatt 3000

tcatagaatt tccatgtgtt ttttttcaat taaccaatta tccaaatctt ccaaactcac 3060

attttgcgga gctgggctat caagaatctg ctgcagtttt ataagacgag catctctgat 3120

atcactgaaa attaattttt aatcaaaact tgaatatcaa ctaaacccac ttattaactt 3180

tctcgatctt ctgtcgttcg gtacgatgac ggtgaagaag ccaattgtag tagttgattt 3240

ggttcaagtc ctttcggtgt tgtacgtcag tgtcctgcaa tgctatttag ttataactta 3300

ggcctaagat tcaatttaat gaagtgatta aatttgttct ctgaacctct taagatgatc 3360

ttttggatta gaaacatata agacaggttt acctatctat taaaaaacag atcaaaatag 3420

atacgaccaa atcggataat ccatgcctac ctggcatcta ggaacgtgtt cttagaagat 3480

ttcttacgta atcgtatgaa gaaataacaa tttgatcgtt ggccagcaaa aatagggttt 3540

taagtgggat agtgttttta ttagctaacc ggaaaatttt atagtttttt tttgcaagaa 3600

accactgaaa accccctaat tgtatacatt ttttggagca gcttctggtc tttttgagca 3660

ataaaattcg ataaaacaga atttaagtgt aaattgttca catttagttt ctattttatc 3720

aaattttgtt gctcaaaaac attcgaagct gctctaaaaa aatgcattaa aaaaggggtt 3780

ttcagtggtt tttcacatta aaaaagctaa ttttaactaa aaatccatca tatttccaac 3840

tttgtcacaa caataaaatg ctggtcaaaa tgtgttcgaa aaaatgtttt tttttttaat 3900

ttttataatt taaaaatagt tttctttcgc tgggacacat acatttttgg gcgtaaattt 3960

tcagttcaaa tttccatttt tacaaccata atcataaagc tacgtctgat ctctctcgca 4020

cttacctgcg cctgattcga aagaacaacc gtagccaaaa gaacaagaag aacaagcacg 4080

tagttgtggt agtggacgtt catcacgcaa tactgaccaa tggtcgtggg gtctcacttt 4140

ccgtactatt gagagagggg agactgaaga tggcaattga ggacagtgtc ttcgacgcac 4200

gcatgcatcc ataagcataa tccaggaggg atggagagaa aaatcttgtt tctaagcccc 4260

tccctttgta atacatacac atatctaata ccgaagaatg gctaattgaa tggacgtcag 4320

ctgttgctgt agttgccaag gcatcatcga tgaaataact gaaagaaaga attaaataat 4380

tattgcaggc gtatccggcg gtcattgaag acttggactt gattgaggag gaggatcaga 4440

tcatccatac acttaatttg gaggatgcgg ttgatccgga aaatgggctt agtaagtgac 4500

tgaccacacg cggggggcat taatttaata aattgaattc catttcagat gtgttcaaac 4560

tagatccaga attcgaaaag aacgaggagg tttatgagga gatccgtaag gaaatcattg 4620

gaaacgccga tatttcggat gaggatggtg gcgacgagtt ggatgatgaa gaagagggta 4680

gtgatgtgga agaggctccg aagaagacta cagagattat tgataatact gatcagaatt 4740

gactgctttc agaaggtatt cattttgagt tttgggccgg caaatctgta agttgccggt 4800

tgccgaaaat ttgctgaatt tgccggaaaa aaaaattccg gaatttattt aaaaactttt 4860

tgtaaaaatt aaattaaatt tgcaactttt cagagaagtc tacctgacaa tgcaatcatc 4920

tttggactac caagaagctg ctcacaaatt gctgaaaatg aagattccag acagcatgca 4980

ggtcagcgat gttgcaaaga aaaattttcg accaaaaaaa ccaaccaatc ataaaattta 5040

aaaaaaaact ccgttttttt cttttttttt atacgagaaa aaccaaaaaa atgtattttt 5100

gccaaattct aaaatactat ccccgaaatt ttcaatattt tctctttcag aacgaactct 5160

gcgcgatgct tgtcgattgt tgtgctcaac agcgtaccta cgagcgattc tacggaatgc 5220

tcatcgaacg tttctgccga cttcgcctcg aataccagca atactttgaa aagctctgcc 5280

aggacacgta ttccacgatt caccgaattg acatcacaaa actgcggaat ttggctcgcc 5340

ttattgctca tttgctctcg acggatgcta ttgactggaa gattttggcc gatatgaaaa 5400

tgaccgaaga ggacacaact tcttctggca gaatctatat taaatatata tttaatgaac 5460

ttgtggaggc gatgggaatg gttaaacttc attcgagagt tactgatccg tgagtttcct 5520

agagagagtt gttttcgtat tcaattttcc ctattttcag aactttggct cattgctttg 5580

ttggattatt cccacgaact aatccgaaca gcgcacgatt ttcgatcaac ttcttcacaa 5640

tgattggatt gggtggtttg acgttggaac ttcgtgaatg gctggcaaag ggtctcaaga 5700

agaagaaggg aatgctggat cagttgaagg ccgaatcaag ctcagattca tcgtcgtctt 5760

cggattcgtc agactcgtct gattcttcgg attctgacga ttcatccgac tcgtcttcag 5820

attcctcatc ttcttcagaa tcagagccag aaccaccgaa gaaaaagaag aagaagaaca 5880

gtgaagagag ttccaaaaag aaggaaaaag agaatattgg tcgacgggat cgtggagaca 5940

agagagctga acgtcatcgt gatcaaagtg tggagaacaa ggacaaggat cgtcgacgtc 6000

gccaggattc tgacgaaaat cgtcggccag aacgaggaga tgaccgcaag gatcggagta 6060

aagatcgtcg tcgtcaagac tcggatgatg aggatcggaa aggtcgtgaa cgtcgggaag 6120

attcagggga aagacgtcgc ggagatcggg atcgacgtga tcgaaacaag gatcaggagg 6180

atcaccgtga agatcgccgt gaccgaagca aggatcgtga ggatcgacgt gatcgccgtc 6240

gtcatgactc tgatgatgat cgtaaaactc gtcgggatag aagtgaagag cgaggaggac 6300

gtcgtcgtga agtggaatcg gatgatcgac gccgacgtcg ttgaattttc aaattttaaa 6360

tactgaatat ttgttttttt tcctattatt tatttattct ctttgtgttt tttttcttgc 6420

tttctaaaaa attaattcaa tccaaatcta aacatgagcg gttttttttc tctttccgtc 6480

tcccaattcg tattccgctc ctctcatctg aacacaatgt gcaagtttat ttatcttctc 6540

gctttcattt cattaggacg tggggggaat tggtggaagg gggaaacaca caaaaggatg 6600

atggaaatga aataaggaca cacaatatgc aacaacattc aattcagaaa tatggaggaa 6660

ggtttaaaag aaaacataaa aatatataga ggaggaagga aaactagtaa aaaataagca 6720

aagaaattag gcgaacgatg agaattgtcc tcgcttggca aatgcgaatc cgtatggaga 6780

ggcacgtttg gcgaaggcaa atgttcggta tggagatctg taaaaatttt taagttgaaa 6840

tttggtgttg ctcttttaca aaattttccg attttcgctt gaaattacgg tgccaggtct 6900

cgacacgtct tccaattttt caaattcaaa agagccttta atgggctgta gttgctaatt 6960

tctcgttttt gaaaattttt cttccgttta atcgaaattt gatgtatttt atttatgatt 7020

ttcaataaat ttcaaagaaa ctggtgaaaa ctcggaaaat tgtgaactac agtaatccaa 7080

tccttaaagg cgcacacctt ttaaatgtcc gccccaatac gatatttttt taagattcgc 7140

tagagcggcc gccaccgcgg tggagctcca attcgcccta tagtgagtcg tattacaatt 7200

cactggccgt cgttttacaa cgtcgtgact gggaaaaccc tggcgttacc caacttaatc 7260

gccttgcagc acatcccccc ttcgccagct ggcgtaatag cgaagaggcc cgcaccgatc 7320

gcccttccca acagttgcgt agcctgaatg gcgaatggga cgcgccctgt agcggcgcat 7380

taagcgcggc gggtgtggtg gttacgcgca gcgtgaccgc tacacttgcc agcgccctag 7440

cgcccgctcc tttcgctttc ttcccttcct ttctcgccac gttcgccggc tttccccgtc 7500

aagctctaaa tcgggggctc cctttagggt tccgatttag tgctttacgg cacctcgacc 7560

ccaaaaaact tgattagggt gatggttcac gtagtgggcc atcgccctga tagacggttt 7620

ttcgcccttt gacgttggag tccacgttct ttaatagtgg actcttgttc caaactggaa 7680

caacactcaa ccctatctcg gtctattctt ttgatttata agggattttg ccgatttcgg 7740

cctattggtt aaaaaatgag ctgatttaac aaaaatttaa cgcgaatttt aacaaaatat 7800

taacgtttac aatttcaggt ggcacttttc ggggaaatgt gcgcggaacc cctatttgtt 7860

tatttttcta aatacattca aatatgtatc cgctcatgag acaataaccc tgataaatgc 7920

ttcaataata ttgaaaaagg aagagtatga gtattcaaca tttccgtgtc gcccttattc 7980

ccttttttgc ggcattttgc cttcctgttt ttgctcaccc agaaacgctg gtgaaagtaa 8040

aagatgctga agatcagttg ggtgcacgag tgggttacat cgaactggat ctcaacagcg 8100

gtaagatcct tgagagtttt cgccccgaag aacgttttcc aatgatgagc acttttaaag 8160

ttctgctatg tggcgcggta ttatcccgta ttgacgccgg gcaagagcaa ctcggtcgcc 8220

gcatacacta ttctcagaat gacttggttg agtactcacc agtcacagaa aagcatctta 8280

cggatggcat gacagtaaga gaattatgca gtgctgccat aagcatgagt gataacactg 8340

cggccaactt acttctgaca acgatcggag gaccgaagga gctaaccgct ttttttcaca 8400

acatggggga tcatgtaact cgccttgatc gttgggaacc ggagctgaat gaagccatac 8460

caaacgacga gcgtgacacc acgatgcctg tagcaatggc aacaacgttg cgcaaactat 8520

taactggcga actacttact ctagcttccc ggcaacaatt aatagactgg atggaggcgg 8580

ataaagttgc aggaccactt ctgcgctcgg cccttccggc tggctggttt attgctgata 8640

aatctggagc cggtgagcgt gggtctcgcg gtatcattgc agcactgggg ccagatggta 8700

agccctcccg tatcgtagtt atctacacga cgggcagtca ggcaactatg gatgaacgaa 8760

atagacagat cgctgagata ggtgcctcac tgattaagca ttggtaactg tcagaccaag 8820

tttactcata tatactttag attgatttaa aacttcattt ttaatttaaa aggatctagg 8880

tgaagatcct ttttgataat ctcatgacca aaatccctta acgtgagttt tcgttccact 8940

gagcgtcaga ccccgtagaa aagatcaaag gatcttcttg agatcctttt tttctgcgcg 9000

taatctgctg cttgcaaaca aaaaaaccac cgctaccagc ggtggtttgt ttgccggatc 9060

aagagctacc aactcttttt ccgaaggtaa ctggcttcag cagagcgcag ataccaaata 9120

ctgtccttct agtgtagccg tagttaggcc accacttcaa gaactctgta gcaccgccta 9180

catacctcgc tctgctaatc ctgttaccag tggctgctgc cagtggcgat aagtcgtgtc 9240

ttaccgggtt ggactcaaga cgatagttac cggataaggc gcagcggtcg ggctgaacgg 9300

ggggttcgtg cacacagccc agcttggagc gaacgaccta caccgaactg agatacctac 9360

agcgtgagca ttgagaaagc gccacgcttc ccgaagggag aaaggcggac aggtatccgg 9420

taagcggcag ggtcggaaca ggagagcgca cgagggagct tccagggggg aacgcctggt 9480

atctttatag tcctgtcggg tttcgccacc tctgacttga gcgtcgattt ttgtgatgct 9540

cgtcaggggg gccgagccta tggaaaaacg ccagcaacgc ggccttttta cggttcctgg 9600

ccttttgctg gccttttgct cacatgttct ttcctgcgtt atcccctgat tctgtggata 9660

accgtattac cgcctttgag tgagctgata ccgctcgccg cagccgaacg accgagcgca 9720

gcgagtcagt gagcgaggaa gcggaagagc gcccaatacg caaaccgcct ctccccgcgc 9780

gttggccgat tcattaatgc agctggcacg acaggtttcc cgactggaaa gcgggcagtg 9840

agcgcaacgc aattaatgtg agttacctca ctcattaggc accccaggct ttacacttta 9900

tgcttccggc tcctatgttg tgtggaattg tgagcggata acaatttcac acaggaaaca 9960

gctatgacca tgattacgcc aagctcggaa ttaaccctca ctaaagggaa caaaagctgg 10020

gggggatcct ccaaaatcgt cttccgctct gaaaaacgaa agtggacctt tgacatccga 10080

aaaaatgggc gaaaaaatga aattgagctt tttgggtcga aaaaaatgtt tttagaatgc 10140

tgagaacacg ttaaacacga agatcatatt tattttgaga cccggatgct ctgaaaatgt 10200

ctgacataga tttaaaaaag catatatata tttttcattt tcaacgtgaa agttttgtgc 10260

aactttatag aatctcctat tggcacattg ttttttattt aactgaggca gtttttgaac 10320

acctttttga aactttgaat ctctttgaag tatactgtcg aaaagactga cttgagcgtt 10380

cgaaatgcca gaagaaaact atatttgaat ctcgcgctaa attgagaaat gcaaccgcgc 10440

tccactggac aattggaaaa aaaatttatt cggaggcgac aacggtattt tcgaaattga 10500

ttttctgtgt attttctcat tttttataaa ttcttctttg atttatcgtt cgtttgtgag 10560

aaatttaatt gtattcaaac ttttttatag taagata 10597



11
10599
DNA
Artificial Sequence

Description of Artificial Sequenceplasmid DNA


11

ccggtggtac cgctagccgt acgaacccgg gttctagaac tagtggatcc cacttgagat 60

caacatgatc agaatcccaa tcagttggct ctggacgacc tggtctatct ggacgatcaa 120

atggattttt agccaaaata tcggtttcag tttccaatgg atcagaaggt ccttcgctgt 180

tgacagcctt gacacggaac ttgtaatgat ctcccttgtt gagtgaatcg actgtgaagt 240

gggtatctcc actacgtcca catggaaccc agattccgtc cttggtgttc atcttttcaa 300

tttcatagaa ctcaattggc tctcctccgt catcctctgg tggtttccag tcaagagttg 360

cacgatcttc gaagacatca gttacctcga ttggtccctt tggtttcgtt ggcttgcttt 420

ttaccttgat attgatagtg acactgtcag ttccattaat gttggttgca gtgatggtat 480

attttccact ttgcttacga agtgcctttg gcaaagcaaa tctcgagatg tatggctcat 540

tttcaatttg agccttgctc tctccgattc cttttccatt gaatgaccat gttacatctg 600

gtgctggctc accatcaata tgaacaatga acttgagagt ggctccgacc ttgacagttg 660

tatcagaaag atcttcacga tgaattcttg gagcaaggtt tcttggcttc gcaacaacac 720

gatcagaagg atcagaagga tctccagttc cagccttgtt acgagcagaa attctgaatt 780

gatattcttc tccctcctta agatttggaa cagttgctgt tttctgatct cctggaacaa 840

cgagagcttc ttcccatcgt ccattcttat ccttcttttc aatgacgaaa gcttatcgat 900

accgtcgacc tcgagggggg gccctcgtcg agtcggtcac aatcacctga aactccaaag 960

gcagccagtg aggaacgtga agaagaagaa aaagagtcat ctgaacaggt ttgattttct 1020

ttctggtcaa aaagatgaaa ttattgattt tcagccagat actcccaaaa ctagcagcga 1080

gaagtctgca agtcgttcac agtcgcccag agaatcgcgg gaagtgagcc aagaggtatg 1140

tttttcaaaa atcaataact gatcataatt tttattgttt ggtgaattta agaaaataat 1200

attcgaaaat tcctctgaat tatcaagatt gcagtattaa tttcgagaaa aattgagata 1260

ttcatagagc tattgtaaat tttcttgatt tcagactgaa acttcggaaa atcaagagaa 1320

aatcaaagaa aaggatgacg gggatgatca gcctggcaca ccgaacagct atagaagccg 1380

ggaaacttca ccagctccaa aaaggtccaa ggagaccagg tttgtcaaaa gcttcctgcg 1440

attaattctc atttcaattt ttcagagaat cagagtctcc tgaaaaatcc ccggttcgtt 1500

caagatctcc cagaaggtct tcagcacgtt ccccgtcacg atctcctaga cggcgccgag 1560

aaagaagctc agaaagaaag caatccgaag agccagcacc gctaccagag aaaaagaaga 1620

aagagccgct ggatattcta cgaacaagaa ccggaggagc atatattcca cccgccaaac 1680

ttcgacttat gcaacaacag attagtgata agcaaagtga acagtatcag agaatgaatt 1740

gggaaagaat gaagaaaaag attcacggat tggttaacag agtcaacgcg aagaatcttg 1800

ttcaaattgt cagagaactt cttcaagaga atgtgattcg ttcaaagtga gtgagaaaat 1860

cgaaggaaaa ggaaagaatt aatttaattt ttcaggggac ttctctgccg tgacattatt 1920

caagctcagg ctttctcacc aggattctct aacgtctatg cagctttggc ggcagttatc 1980

aactcgaaat tccctcatgt cggtgaactt cttctccgtc gtctgattgt acagttcaaa 2040

agaagtttcc gtagaaatga cagaggcgtc acggtgaacg tgatcaaatt catcgcacat 2100

ttgattaatc aacaagttgc tcacgaagtt cttgcgctgg aaatcatgat tctgatgctt 2160

gaagaaccaa ctgatgattc agttgaagtc gccattgcgt tcctgaaaga gtgtggagca 2220

aagcttctgg agattgctcc agcagctctt aacagtgtct acgaccgtct tcgtgcaatt 2280

ctcatggaaa ctgaaagatc ggaaaatgca ctggatcgac gtattcagta tatgattgag 2340

actgcaatgc agattcgaaa ggacaaattt gcggtaaggt agaatatata aatagtttat 2400

tagaaaaaaa taaattagaa taatttaaat tcctactagc caatcaggcg acctttttgc 2460

gcatagttct attattgaaa aatttggaga atttctcata ttctcgctcg gaaatctgga 2520

attcgacgag atcttctggc ttctgtgcag ctgcatcgct ttgtgctccc tttctcgctt 2580

gtcttctgtg tacaccaaga accttgttga gttcatcaac tgaatctgtg actggcttgt 2640

tgctcactgg atgcactaga cgactgattc tcgagaaatc agattgagtt gcgattaggg 2700

tgacctagaa attgggaata atacgaactt ttgaaaatat tcaggaggat taaaaaaatt 2760

attctcgaca atcctacaaa tttacttatt gcaccatgtt gctccaacat ttttcattaa 2820

aagttaatga aaaaatgtag aaaatcggaa attggcaatt ttcagaccat ttttaagcat 2880

tttcaaaaaa aaattgcagc tgaaataaat gtcattttca gataaatcga gcgattttct 2940

gttgtctgac actagttttt agttttaaaa aatgttggaa gaacatggtg caataggtaa 3000

tttcatagaa tttccatgtg ttttttttca attaaccaat tatccaaatc ttccaaactc 3060

acattttgcg gagctgggct atcaagaatc tgctgcagtt ttataagacg agcatctctg 3120

atatcactga aaattaattt ttaatcaaaa cttgaatatc aactaaaccc acttattaac 3180

tttctcgatc ttctgtcgtt cggtacgatg acggtgaaga agccaattgt agtagttgat 3240

ttggttcaag tcctttcggt gttgtacgtc agtgtcctgc aatgctattt agttataact 3300

taggcctaag attcaattta atgaagtgat taaatttgtt ctctgaacct cttaagatga 3360

tcttttggat tagaaacata taagacaggt ttacctatct attaaaaaac agatcaaaat 3420

agatacgacc aaatcggata atccatgcct acctggcatc taggaacgtg ttcttagaag 3480

atttcttacg taatcgtatg aagaaataac aatttgatcg ttggccagca aaaatagggt 3540

tttaagtggg atagtgtttt tattagctaa ccggaaaatt ttatagtttt tttttgcaag 3600

aaaccactga aaacccccta attgtataca ttttttggag cagcttctgg tctttttgag 3660

caataaaatt cgataaaaca gaatttaagt gtaaattgtt cacatttagt ttctatttta 3720

tcaaattttg ttgctcaaaa acattcgaag ctgctctaaa aaaatgcatt aaaaaagggg 3780

ttttcagtgg tttttcacat taaaaaagct aattttaact aaaaatccat catatttcca 3840

actttgtcac aacaataaaa tgctggtcaa aatgtgttcg aaaaaatgtt ttttttttta 3900

atttttataa tttaaaaata gttttctttc gctgggacac atacattttt gggcgtaaat 3960

tttcagttca aatttccatt tttacaacca taatcataaa gctacgtctg atctctctcg 4020

cacttacctg cgcctgattc gaaagaacaa ccgtagccaa aagaacaaga agaacaagca 4080

cgtagttgtg gtagtggacg ttcatcacgc aatactgacc aatggtcgtg gggtctcact 4140

ttccgtacta ttgagagagg ggagactgaa gatggcaatt gaggacagtg tcttcgacgc 4200

acgcatgcat ccataagcat aatccaggag ggatggagag aaaaatcttg tttctaagcc 4260

cctccctttg taatacatac acatatctaa taccgaagaa tggctaattg aatggacgtc 4320

agctgttgct gtagttgcca aggcatcatc gatgaaataa ctgaaagaaa gaattaaata 4380

attattgcag gcgtatccgg cggtcattga agacttggac ttgattgagg aggaggatca 4440

gatcatccat acacttaatt tggaggatgc ggttgatccg gaaaatgggc ttagtaagtg 4500

actgaccaca cgcggggggc attaatttaa taaattgaat tccatttcag atgtgttcaa 4560

actagatcca gaattcgaaa agaacgagga ggtttatgag gagatccgta aggaaatcat 4620

tggaaacgcc gatatttcgg atgaggatgg tggcgacgag ttggatgatg aagaagaggg 4680

tagtgatgtg gaagaggctc cgaagaagac tacagagatt attgataata ctgatcagaa 4740

ttgactgctt tcagaaggta ttcattttga gttttgggcc ggcaaatctg taagttgccg 4800

gttgccgaaa atttgctgaa tttgccggaa aaaaaaattc cggaatttat ttaaaaactt 4860

tttgtaaaaa ttaaattaaa tttgcaactt ttcagagaag tctacctgac aatgcaatca 4920

tctttggact accaagaagc tgctcacaaa ttgctgaaaa tgaagattcc agacagcatg 4980

caggtcagcg atgttgcaaa gaaaaatttt cgaccaaaaa aaccaaccaa tcataaaatt 5040

taaaaaaaaa ctccgttttt ttcttttttt ttatacgaga aaaaccaaaa aaatgtattt 5100

ttgccaaatt ctaaaatact atccccgaaa ttttcaatat tttctctttc agaacgaact 5160

ctgcgcgatg cttgtcgatt gttgtgctca acagcgtacc tacgagcgat tctacggaat 5220

gctcatcgaa cgtttctgcc gacttcgcct cgaataccag caatactttg aaaagctctg 5280

ccaggacacg tattccacga ttcaccgaat tgacatcaca aaactgcgga atttggctcg 5340

ccttattgct catttgctct cgacggatgc tattgactgg aagattttgg ccgatatgaa 5400

aatgaccgaa gaggacacaa cttcttctgg cagaatctat attaaatata tatttaatga 5460

acttgtggag gcgatgggaa tggttaaact tcattcgaga gttactgatc cgtgagtttc 5520

ctagagagag ttgttttcgt attcaatttt ccctattttc agaactttgg ctcattgctt 5580

tgttggatta ttcccacgaa ctaatccgaa cagcgcacga ttttcgatca acttcttcac 5640

aatgattgga ttgggtggtt tgacgttgga acttcgtgaa tggctggcaa agggtctcaa 5700

gaagaagaag ggaatgctgg atcagttgaa ggccgaatca agctcagatt catcgtcgtc 5760

ttcggattcg tcagactcgt ctgattcttc ggattctgac gattcatccg actcgtcttc 5820

agattcctca tcttcttcag aatcagagcc agaaccaccg aagaaaaaga agaagaagaa 5880

cagtgaagag agttccaaaa agaaggaaaa agagaatatt ggtcgacggg atcgtggaga 5940

caagagagct gaacgtcatc gtgatcaaag tgtggagaac aaggacaagg atcgtcgacg 6000

tcgccaggat tctgacgaaa atcgtcggcc agaacgagga gatgaccgca aggatcggag 6060

taaagatcgt cgtcgtcaag actcggatga tgaggatcgg aaaggtcgtg aacgtcggga 6120

agattcaggg gaaagacgtc gcggagatcg ggatcgacgt gatcgaaaca aggatcagga 6180

ggatcaccgt gaagatcgcc gtgaccgaag caaggatcgt gaggatcgac gtgatcgccg 6240

tcgtcatgac tctgatgatg atcgtaaaac tcgtcgggat agaagtgaag agcgaggagg 6300

acgtcgtcgt gaagtggaat cggatgatcg acgccgacgt cgttgaattt tcaaatttta 6360

aatactgaat atttgttttt tttcctatta tttatttatt ctctttgtgt tttttttctt 6420

gctttctaaa aaattaattc aatccaaatc taaacatgag cggttttttt tctctttccg 6480

tctcccaatt cgtattccgc tcctctcatc tgaacacaat gtgcaagttt atttatcttc 6540

tcgctttcat ttcattagga cgtgggggga attggtggaa gggggaaaca cacaaaagga 6600

tgatggaaat gaaataagga cacacaatat gcaacaacat tcaattcaga aatatggagg 6660

aaggtttaaa agaaaacata aaaatatata gaggaggaag gaaaactagt aaaaaataag 6720

caaagaaatt aggcgaacga tgagaattgt cctcgcttgg caaatgcgaa tccgtatgga 6780

gaggcacgtt tggcgaaggc aaatgttcgg tatggagatc tgtaaaaatt tttaagttga 6840

aatttggtgt tgctctttta caaaattttc cgattttcgc ttgaaattac ggtgccaggt 6900

ctcgacacgt cttccaattt ttcaaattca aaagagcctt taatgggctg tagttgctaa 6960

tttctcgttt ttgaaaattt ttcttccgtt taatcgaaat ttgatgtatt ttatttatga 7020

ttttcaataa atttcaaaga aactggtgaa aactcggaaa attgtgaact acagtaatcc 7080

aatccttaaa ggcgcacacc ttttaaatgt ccgccccaat acgatatttt tttaagattc 7140

gctagagcgg ccgccaccgc ggtggagctc caattcgccc tatagtgagt cgtattacaa 7200

ttcactggcc gtcgttttac aacgtcgtga ctgggaaaac cctggcgtta cccaacttaa 7260

tcgccttgca gcacatcccc ccttcgccag ctggcgtaat agcgaagagg cccgcaccga 7320

tcgcccttcc caacagttgc gtagcctgaa tggcgaatgg gacgcgccct gtagcggcgc 7380

attaagcgcg gcgggtgtgg tggttacgcg cagcgtgacc gctacacttg ccagcgccct 7440

agcgcccgct cctttcgctt tcttcccttc ctttctcgcc acgttcgccg gctttccccg 7500

tcaagctcta aatcgggggc tccctttagg gttccgattt agtgctttac ggcacctcga 7560

ccccaaaaaa cttgattagg gtgatggttc acgtagtggg ccatcgccct gatagacggt 7620

ttttcgccct ttgacgttgg agtccacgtt ctttaatagt ggactcttgt tccaaactgg 7680

aacaacactc aaccctatct cggtctattc ttttgattta taagggattt tgccgatttc 7740

ggcctattgg ttaaaaaatg agctgattta acaaaaattt aacgcgaatt ttaacaaaat 7800

attaacgttt acaatttcag gtggcacttt tcggggaaat gtgcgcggaa cccctatttg 7860

tttatttttc taaatacatt caaatatgta tccgctcatg agacaataac cctgataaat 7920

gcttcaataa tattgaaaaa ggaagagtat gagtattcaa catttccgtg tcgcccttat 7980

tccctttttt gcggcatttt gccttcctgt ttttgctcac ccagaaacgc tggtgaaagt 8040

aaaagatgct gaagatcagt tgggtgcacg agtgggttac atcgaactgg atctcaacag 8100

cggtaagatc cttgagagtt ttcgccccga agaacgtttt ccaatgatga gcacttttaa 8160

agttctgcta tgtggcgcgg tattatcccg tattgacgcc gggcaagagc aactcggtcg 8220

ccgcatacac tattctcaga atgacttggt tgagtactca ccagtcacag aaaagcatct 8280

tacggatggc atgacagtaa gagaattatg cagtgctgcc ataagcatga gtgataacac 8340

tgcggccaac ttacttctga caacgatcgg aggaccgaag gagctaaccg ctttttttca 8400

caacatgggg gatcatgtaa ctcgccttga tcgttgggaa ccggagctga atgaagccat 8460

accaaacgac gagcgtgaca ccacgatgcc tgtagcaatg gcaacaacgt tgcgcaaact 8520

attaactggc gaactactta ctctagcttc ccggcaacaa ttaatagact ggatggaggc 8580

ggataaagtt gcaggaccac ttctgcgctc ggcccttccg gctggctggt ttattgctga 8640

taaatctgga gccggtgagc gtgggtctcg cggtatcatt gcagcactgg ggccagatgg 8700

taagccctcc cgtatcgtag ttatctacac gacgggcagt caggcaacta tggatgaacg 8760

aaatagacag atcgctgaga taggtgcctc actgattaag cattggtaac tgtcagacca 8820

agtttactca tatatacttt agattgattt aaaacttcat ttttaattta aaaggatcta 8880

ggtgaagatc ctttttgata atctcatgac caaaatccct taacgtgagt tttcgttcca 8940

ctgagcgtca gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg 9000

cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca gcggtggttt gtttgccgga 9060

tcaagagcta ccaactcttt ttccgaaggt aactggcttc agcagagcgc agataccaaa 9120

tactgtcctt ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc 9180

tacatacctc gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg 9240

tcttaccggg ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac 9300

ggggggttcg tgcacacagc ccagcttgga gcgaacgacc tacaccgaac tgagatacct 9360

acagcgtgag cattgagaaa gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc 9420

ggtaagcggc agggtcggaa caggagagcg cacgagggag cttccagggg ggaacgcctg 9480

gtatctttat agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg 9540

ctcgtcaggg gggccgagcc tatggaaaaa cgccagcaac gcggcctttt tacggttcct 9600

ggccttttgc tggccttttg ctcacatgtt ctttcctgcg ttatcccctg attctgtgga 9660

taaccgtatt accgcctttg agtgagctga taccgctcgc cgcagccgaa cgaccgagcg 9720

cagcgagtca gtgagcgagg aagcggaaga gcgcccaata cgcaaaccgc ctctccccgc 9780

gcgttggccg attcattaat gcagctggca cgacaggttt cccgactgga aagcgggcag 9840

tgagcgcaac gcaattaatg tgagttacct cactcattag gcaccccagg ctttacactt 9900

tatgcttccg gctcctatgt tgtgtggaat tgtgagcgga taacaatttc acacaggaaa 9960

cagctatgac catgattacg ccaagctcgg aattaaccct cactaaaggg aacaaaagct 10020

gggggggatc ctccaaaatc gtcttccgct ctgaaaaacg aaagtggacc tttgacatcc 10080

gaaaaaatgg gcgaaaaaat gaaattgagc tttttgggtc gaaaaaaatg tttttagaat 10140

gctgagaaca cgttaaacac gaagatcata tttattttga gacccggatg ctctgaaaat 10200

gtctgacata gatttaaaaa agcatatata tatttttcat tttcaacgtg aaagttttgt 10260

gcaactttat agaatctcct attggcacat tgttttttat ttaactgagg cagtttttga 10320

acaccttttt gaaactttga atctctttga agtatactgt cgaaaagact gacttgagcg 10380

ttcgaaatgc cagaagaaaa ctatatttga atctcgcgct aaattgagaa atgcaaccgc 10440

gctccactgg acaattggaa aaaaaattta ttcggaggcg acaacggtat tttcgaaatt 10500

gattttctgt gtattttctc attttttata aattcttctt tgatttatcg ttcgtttgtg 10560

agaaatttaa ttgtattcaa acttttttat agtaagata 10599



12
23
DNA
Artificial Sequence

Description of Artificial Sequence T7 promoter
DNA


12

taatacgact cactataggg cga 23



13
35
DNA
Artificial Sequence

Description of Artificial Sequence
oligonucleotide DNA


13

agctgtaata cgactcacta tagggcgaga agctt 35



14
35
DNA
Artificial Sequence

Description of Artificial Sequence
oligonucleotide DNA


14

tcgaaagctt ctcgcataat agtgagtcgt attac 35



15
29
DNA
Artificial Sequence

Description of Artificial Sequence
oligonucleotide DNA


15

catggcagga tgaacacgat taacatcgc 29



16
32
DNA
Artificial Sequence

Description of Artificial Sequence
oligonucleotide DNA


16

atggccccat ggttacggga acgcgaagtc cg 32



17
29
DNA
Artificial Sequence

Description of Artificial Sequence
oligonucleotide DNA


17

atggaattct tacgcgaacg cgaagtccg 29



18
30
DNA
Artificial Sequence

Description of Artificial Sequence
oligonucleotide DNA


18

ctcaccggta atgaacacga ttaacatcgc 30



19
12
PRT
Simian virus 40

19

Met Thr Ala Pro Lys Lys Lys Arg Lys Val Pro Val
1 5 10



20
37
DNA
Artificial Sequence

Description of Artificial Sequence
oligonucleotide DNA


20

gccaccggtg cgagctcatg aacacgatta acatcgc 37



21
33
DNA
Artificial Sequence

Description of Artificial Sequence
oligonucleotide DNA


21

cactagtggg cccttacgcg aacgcgaagt ccg 33



22
33
DNA
Artificial Sequence

Description of Artificial Sequence
oligonucleotide DNA


22

ccggatgact gctccaaaga agaagcgtaa gct 33



23
25
DNA
Artificial Sequence

Description of Artificial Sequence
oligonucleotide DNA


23

cccgggatta atacgactca ctata 25



24
33
DNA
Artificial Sequence

Description of Artificial Sequence
oligonucleotide DNA


24

ccggtatagt gagtcgtatt aatcccggga gct 33



25
28
DNA
Artificial Sequence

Description of Artificial Sequence
oligonucleotide DNA


25

aattcttaat acgactcact atagggcc 28



26
28
DNA
Artificial Sequence

Description of Artificial Sequence
oligonucleotide DNA


26

catgggccct atagtgagtc gtattaag 28



27
42
DNA
Artificial Sequence

Description of Artificial Sequence
oligonucleotide DNA


27

gatccgtcga cagatctccc tatagtgagt cgtattactg ca 42



28
34
DNA
Artificial Sequence

Description of Artificial Sequence
oligonucleotide DNA


28

gtaatacgac tcactatagg gagatctgtc gacg 34



29
26
DNA
Artificial Sequence

Description of Artificial Sequence
oligonucleotide DNA


29

tatgccctat agtgagtcgt attaag 26