(en)Novel enzymes and novel enzymatic pathways for the pyruvate-based synthesis of shikimate or at least one intermediate thereto or derivative thereof, nucleic acids encoding the enzymes, cells transformed therewith, and kits containing said enzymes, cells, or nucleic acid. A KDPGal aldolase is used to perform condensation of pyruvate with D-erythrose 4-phosphate to form 3-deoxy-D-arabino-heptulosonate-7-phosphate (DAHP); a 3-dehydroquinate synthase is used to convert the DAHP to 3-dehydroquinate (DHQ); DHQ dehydratase can then convert DHQ to the key shikimate intermediate, 3-dehydroshikimate.

1.ApplicationNumber: US-57297604-A
1.PublishNumber: US-7790431-B2
2.Date Publish: 20100907
3.Inventor: FROST JOHN W.

4.Inventor Harmonized: FROST JOHN W(US)

5.Country: US
6.Claims:
(en)Novel enzymes and novel enzymatic pathways for the pyruvate-based synthesis of shikimate or at least one intermediate thereto or derivative thereof, nucleic acids encoding the enzymes, cells transformed therewith, and kits containing said enzymes, cells, or nucleic acid. A KDPGal aldolase is used to perform condensation of pyruvate with D-erythrose 4-phosphate to form 3-deoxy-D-arabino-heptulosonate-7-phosphate (DAHP); a 3-dehydroquinate synthase is used to convert the DAHP to 3-dehydroquinate (DHQ); DHQ dehydratase can then convert DHQ to the key shikimate intermediate, 3-dehydroshikimate.

7.Description:
(en)CROSS REFERENCE TO RELATED APPLICATION
This application is the National Stage of International application PCT/US2004/031417 filed on Sep. 24, 2004, and published as WO 2005/030949 A1, which claims the benefit of U.S. Provisional Patent Application No. 60/505,658, filed on Sep. 24, 2003, now expired, each of the foregoing of which is incorporated by reference herein in its entirety.


This invention was made with Government support under Contract 08-R1GM065541A, awarded by the National Institutes of Health. The Government may have certain rights in this invention.


INTRODUCTION
The present invention relates to methods, materials and organisms for the production of shikimic acid and related compounds. In particular, such methods relate to microbial synthetic processes using pyruvate.
Shikimic acid is an attractive chiral compound useful in a variety of synthetic reaction. It has a highly functionalized, six-membered carbocyclic ring, and multiple asymmetric centers. A metabolic intermediate of aromatic amino acid biosynthesis, shikimic acid is a commercially valuable chiral starting material in the synthesis of neuraminidase inhibitors effective in the treatment of influenza. See, e.g., Kim. C. U. et al., J. Am. Chem. Soc. 119:681 (1997); and Rohloff, J. C. et al., J. Org. Chem. 63:4545 (1998). Chiral, as well as aromatic chemicals, can also be synthesized from shikimic acid. For example, acid catalyzed dehydration of shikimic acid affords p-hydroxybenzoic acid, which has an annual production of over seven million kilograms, and is the key precursor to parabens and a monomer used in the synthesis of liquid crystal polymers. Shikimic acid has also been used as the starting point for synthesis of a large combinatorial library of molecules. See, e.g., Tan, D. S. et al., J. Am. Chem. Soc. 120:8565 (1998).
Shikimic acid may be obtained via tedious multi-step isolation procedures from plants. Unfortunately, current isolation of shikimic acid from the fruit of Illicium plants (Haslem, E., “Shikimic Acid: Metabolism and Metabolites,” Wiley & Sons, New York, pp. 40-42 (1993)) precludes its use in kilogram-level synthesis
Microbial synthesis of shikimic acid is disclosed in U.S. Pat. No. 5,168,056, Frost, issued Dec. 1, 1992; U.S. Pat. No. 5,272,073, Frost et al., issued Dec. 21, 1993: U.S. Pat. No. 5,629,181, Frost et al., issued May 13, 1997; and U.S. Pat. No. 6,613,552, Frost et al., issued Sep. 2, 2003. Such methods employ variations on the common pathway for aromatic amino acid biosynthesis.
Phosphoenolpyruvate (PEP) is a substrate for the first committed step in the shikimate pathway ( FIG. 1 ) and is also used by the carbohydrate phosphotransferase (PTS) system for microbial transport and phosphorylation of glucose. The resulting competition between the shikimate pathway and PTS-mediated glucose transport for cytoplasmic supplies of phosphoenolpyruvate limits the concentrations and yields of natural products microbially synthesized by way of the shikimate pathway.
SUMMARY
The present invention provides methods for producing shikimic acid comprising enzyme-catalyzed condensation of pyruvate with D-erythrose 4-phosphate to form 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP). Also provided are methods for making shikimic acid, as depicted in FIG. 2 , and transfected microbes expressing 2-keto-3-deoxy-6-phosphogalactonate (KDPGal) aldolase.
The present invention further provides:
Recombinant KDPGal aldolase polypeptides having the ability to catalyze the condensation of pyruvate and E4P to from DAHP, containing at least one mutation that is X10V, X28L or X28M, X42T, X85A, X154F, or X196I; KDPGal aldolase polypeptides containing at least one mutation that is I10V, V28L or V28M, S42T, V85A, V154F, or F196I; KDPGal aldolase polypeptides having, apart from one of these mutations, the amino acid sequence of any one of SEQ ID NO:2, SEQ ID NO:4, and SEQ ID NO:6, or an amino acid sequence at least 50% homologous to one of these; recombinant KDPGal aldolase polypeptides whose amino acid sequences are variants of a native KDPGal aldolase amino acid sequence; Nucleic acid encoding such a recombinant KDPGal aldolase polypeptide; vectors containing such nucleic acid; Enzymatic pathways capable of converting pyruvate and D-erythrose 4-phosphate (E4P) into 3-deoxy-D-arabino-heptulosonate-7-phosphate (DAHP), by virtue of their having at least one KDPGal aldolase; such enzymatic pathways also capable of converting DAHP to DHQ by virtue of their having at least one DHQ synthase, and optionally at least one DHQ dehydratase, and further optionally at least one shikimate dehydrogenase; Methods for the production of shikimate or a shikimate intermediate, such as DAHP, DHQ, or DHS, by growing a recombinant host cell containing nucleic acid encoding at least one KDPGal aldolase and at least one DHQ synthase, such that the cell expresses those enzymes. Methods for converting pyruvate and E4P to DAHP or a derivative of DAHP in vitro or in vivo/in cyto; The use of a recombinant KDPGal aldolase to produce DAHP from pyruvate and E4P; the use of a combination of recombinant KDPGal aldolase and DHQ synthase to produce DHQ. Process for preparing recombinant cells capable of expressing a KDPGal aldolase, and thus of converting pyruvate and E4P to DAHP by providing a host cell capable of synthesizing pyruvate and E4P, providing a vector containing a polynucleotide from which said host cell can express a KDPGal aldolase, and transforming said cell with said vector to produce a transformed cell, and, optionally, expressing the KDPGal aldolase, whereupon the cell converts pyruvate and E4P to DAHP. Recombinant cells prepared thereby; Processes for preparing DAHP or a derivative thereof, by providing (A) a supply of E4P and pyruvate, (B) a KDPGal aldolase, and optionally a DHQ synthase, (C) an aqueous medium; contacting the KDPGal aldolase with the E4P and pyruvate under conditions in which the KDPGal aldolase can catalyze the formation of DAHP therefrom, and optionally contacting the DAHP with the DHQ synthase under conditions in which the DHQ synthase can catalyze the formation of 3-dehydroquinate from the DAHP; and optionally recovering at least one of DAHP, DHQ, DHS, or a further-derivative thereof; In vivo embodiments of such methods, pathways, and cells further including a recombinant transketolase or a recombinant transaldolase; Kits containing a KDPGal aldolase preparation, with instructions for the use thereof to convert pyruvate and E4P to DAHP, and optionally with instructions for the conversion of said DAHP to at least one derivative thereof; Kits containing a cell capable of expressing a KDPGal aldolase, with instructions for the use thereof to convert pyruvate and E4P to DAHP, and optionally with instructions for the conversion of said DAHP to at least one derivative thereof; Kits containing nucleic acid from which a cell can express at least one KDPGal aldolase, with instructions for the use thereof to transform a cell to produce a transformed cell that is capable of converting pyruvate and E4P to DAHP, and optionally to at least one derivative thereof.




FIGURES
FIG. 1 depicts a synthetic scheme for 3-dehydroshikimate.
FIG. 2 depicts a synthetic scheme for shikimic acid and intermediate compounds.
FIG. 3 sets forth restriction enzyme maps for plasmids useful in the methods of this invention.
FIG. 4 is a plot depicting showing the growth of organisms among those useful herein.
FIG. 5 depicts a synthetic scheme for enhanced conversion of glucose to DAHP via a pyruvate-based pathway according to the present invention. The numbers are the relative fluxes involved in converting 7 mol of glucose into DAHP. Enzymes are: Pps, PEP synthase; Tkt, transketolase; Tal, transaldolase. Metabolites are: G6P, glucose 6-phosphate; F6P, fructose 6-phosphate; 1,6-FDP, 1,6-fructose diphosphate; DHAP, dihydroxyacetone phosphate; GAP, glyceraldehyde 3-phosphate; R5P: ribose 5-phosphate; X5P, xylulose 5-phosphate; S7P, sedoheptulose 7-phosphate; PYR, pyruvate. This scheme shows that E4P production can be improved by enhancing expression of Tkt and/or Tal, thereby increasing the synthesis of DAHP by KDPGal aldolase.



It should be noted that the figures set forth herein are intended to exemplify the general characteristics of an apparatus, materials and methods among those of this invention, for the purpose of the description of such embodiments herein. These figures may not precisely reflect the characteristics of any given embodiment, and are not necessarily intended to define or limit specific embodiments within the scope of this invention.
DESCRIPTION
The present invention provides methods, materials and organisms for producing shikimic acid and intermediates. The following definitions and non-limiting guidelines must be considered in reviewing the description of this invention set forth herein.
The headings (such as “Introduction” and “Summary,”) and sub-headings used herein are intended only for general organization of topics within the disclosure of the invention, and are not intended to limit the disclosure of the invention or any aspect thereof. In particular, subject matter disclosed in the “Introduction” may include aspects of technology within the scope of the invention, and may not constitute a recitation of prior art. Subject matter disclosed in the “Summary” is not an exhaustive or complete disclosure of the entire scope of the invention or any embodiments thereof.
The citation of references herein does not constitute an admission that those references are prior art or have any relevance to the patentability of the invention disclosed herein. Any discussion of the content of references cited in the Introduction is intended merely to provide a general summary of assertions made by the authors of the references, and does not constitute an admission as to the accuracy of the content of such references. All references cited in the Description section of this specification are hereby incorporated by reference in their entirety.
The description and specific examples, while indicating embodiments of the invention, are intended for purposes of illustration only and are not intended to limit the scope of the invention. Moreover, recitation of multiple embodiments having stated features is not intended to exclude other embodiments having additional features, or other embodiments incorporating different combinations the stated of features.
As used herein, the words “preferred” and “preferably” refer to embodiments of the invention that afford certain benefits, under certain circumstances. However, other embodiments may also be preferred, under the same or other circumstances. Furthermore, the recitation of one or more preferred embodiments does not imply that other embodiments are not useful, and is not intended to exclude other embodiments from the scope of the invention.
As used herein, the word “include,” and its variants, is intended to be non-limiting, such that recitation of items in a list is not to the exclusion of other like items that may also be useful in the materials, compositions, devices, and methods of this invention.
The word :“recombinant” is used herein to indicate that nucleic acid manipulation was employed. As a result, phrases such as “recombinant” nucleic acid, “recombinant” polypeptide, and “recombinant” cell to entities that were produced, at least in part, by nucleic acid manipulation.
Sequence Homology
In a preferred embodiment, a mutant polypeptide according to the present invention will have an amino acid sequence that is at least 50% homologous to that of a native polypeptide performing the same function as the mutant. By way of example, a KDPGal aldolase according to the present invention will have an amino acid sequence at least 50% homologous to that of any of SEQ ID NO:2, SEQ ID NO:4, and SEQ ID NO:6; in a preferred embodiment, the sequence will be at least 60% homologous thereto; in a preferred embodiment, the sequence will be at least 70% homologous thereto; in a preferred embodiment, the sequence will be at least 80% homologous thereto; in a preferred embodiment, the sequence will be at least 90% homologous thereto.
In one embodiment, a recombinant polynucleotide according to the present invention, which encodes a desired polypeptide, will be any that encodes a polypeptide having homology to a native polypeptide of the same function, as described above. In one embodiment, a recombinant polynucleotide according to the present invention, which encodes a desired polypeptide, will have an amino acid sequence that is more than 80% homologous to that of a native polynucleotide encoding a polypeptide performing the same function as the mutant. In a preferred embodiment, the polynucleotide will be at least 85% homologous thereto; in a preferred embodiment, the polynucleotide will be at least 90% homologous thereto; in a preferred embodiment, the polynucleotide will be at least 95% homologous thereto.
Sequence homology refers to the degree of identicality between two sequences of amino acid residues, or between two sequences of nucleobases. This may be determined by visual comparison of two sequences, or by use of bioinformatic algorithms that align sequences for comparison or that determine percent homology among compared sequences. Useful automated algorithms are available in the GAP, BESTFIT, FASTA, and TFASTA computer software modules of the Wisconsin Genetics Software Package (available from Genetics Computer Group, Madison, Wis., USA). The alignment algorithms automated in those modules include the Needleman & Wunsch, the Pearson & Lipman, and the Smith & Waterman sequence alignment algorithms. Other useful algorithms for sequence alignment and homology determination are automated in software including: FASTP, BLAST, BLAST2, PSIBLAST, and CLUSTAL V; see, e.g., N. P. Brown et al., Bioinformatics : Applications Note, 1998, 14:380-81; the U.S. National Center for Biotechnology Information at http://www.ncbi.nlm.nih.gov/Tools/index.html; and U.S. Pat. No. 6,790,639, which provides software parameter settings useful for homology determination herein.
The sequence homology exhibited by nucleobase polymers, such as nucleic acids and nucleic acid analogs, may be determined by hybridization assays between a first sequence and the complement of a second sequence. Any of the well known hybridization assays may be used for this purpose, and examples of these include those described in U.S. Pat. Nos. 6,767,744, and 6,783,758, with “high stringency” hybridization conditions being as defined therein.
Conservative Substitutions
In addition, conservative amino acid substitutions may be present in a polypeptide according to the present invention. The term “conservative amino acid substitution” indicates any amino acid substitution for a given amino acid residue, where the substitute residue is so chemically similar to that of the given residue that no substantial decrease in polypeptide function (e.g., enzymatic activity) results. Conservative amino acid substitutions are commonly known in the art and examples thereof are described, e.g., in U.S. Pat. Nos. 6,790,639, 6,774,107, 6,194,167, or 5,350,576. In a preferred embodiment, a conservative amino acid substitution will be any one that occurs within one of the following six groups
1. Small aliphatic, substantially non-polar residues: Ala, Gly, Pro, Ser, and Thr; 2. Large aliphatic, non-polar residues: Ile, Leu, and Val; Met; 3. Polar, negatively charged residues and their amides: Asp and Glu; 4. Amides of polar, negatively charged residues: Asn and Gin; His; 5. Polar, positively charged residues: Arg and Lys; His; and 6. Large aromatic residues: Trp and Tyr; Phe.

In a preferred embodiment, a conservative amino acid substitution will be any one of the following, which are listed as Native Residue (Conservative Substitutions) pairs: Ala (Ser); Arg (Lys); Asn (Gln; His); Asp (Glu); Gin (Asn); Glu (Asp); Gly (Pro); His (Asn; Gin); Ile (Leu; Val); Leu (Ile; Val); Lys (Arg; Gin; Glu); Met (Leu; Ile); Phe (Met; Leu; Tyr); Ser (Thr); Thr (Ser); Trp (Tyr); Tyr (Trp; Phe); and Val (Ile; Leu).


Just as a polypeptide may contain conservative amino acid substitution(s), a polynucleotide hereof may contain conservative codon substitution(s). A codon substitution is considered conservative if, when expressed, it produces a conservative amino acid substitution, as described above. Degenerate codon substitution, which results in no amino acid substitution, is also useful in polynucleotides according to the present invention. Thus, e.g., a polynucleotide encoding a selected polypeptide useful in an embodiment of the present invention may be mutated by degenerate codon substitution in order to approximate the codon usage frequency exhibited by an expression host cell to be transformed therewith, or to otherwise improve the expression thereof.
Production of Shikimate and its Precursors
In various embodiments, methods of this invention comprise the production of shikimate and shikimic acid according to the reaction schemes set forth in FIG. 2 . As referred to in FIG. 2 , “G3P” is D-glyceraldehyde 3-phosphate; “E4P” is D-erythrose 4-phosphate; “KDPGal” is 2-keto-3-deoxy-6-phosphogalactonate; “DAHP” is 3-deoxy-D-arabino-heptulosonate-7-phosphate. The enzymes used in the depicted method are (a) KDPGal aldolase (DgoA; also called 2-dehydro-3-deoxy-6-phosphogalactonate aldolase; E.C. 4.1.2.21); (b) DAHP synthase (AroF, AroG, AroH); (c) 3-dehydroquinate synthase (AroB); (d) 3-dehydroquinate dehydratase (AroD); and (e) shikimate dehydrogenase (AroE). In other embodiments, methods of this invention comprise the production of at least one of DAHP, DHQ (3-dehydroquinate), or DHS (3-dehydroshikimate).
By catalyzing the reversible cleavage of KDPGal to pyruvate and D-glyceraldehyde 3-phosphate (G3P, FIG. 2 ), KDPGal aldolase enables microbes (e.g., E. coli ) to use D-galactonate as a sole carbon source. In one embodiment, E. coli dgoA-encoded KDPGal aldolase is overexpressed, partially purified, and incubated with pyruvate, D-erythrose 4-phosphate (E4P), 3-dehydroquinate synthase, and 3-dehydroquinate dehydratase to form 3-dehydroshikimate. Dehydratase-catalyzed dehydration of 3-dehydroquinate provides in product 3-dehydroshikimate a chromophore suitable for continuous spectrophotometric assay.
In one embodiment, KDPGal aldolase is incubated with pyruvate and D-erythrose 4-phosphate to form DAHP; in one embodiment, KDPGal aldolase is incubated with pyruvate, D-erythrose 4-phosphate, and 3-dehydroquinate synthase to form DHQ. In one embodiment, KDPGal is expressed in a cell that provides pyruvate and E4P; DAHP can be formed thereby. In one embodiment, KDPGal is expressed in a cell that provides pyruvate, E4P, and 3-dehydroquinate synthase; DHQ can be formed thereby.
Production systems according to the present invention may be in vivo systems or in vitro systems. In vitro systems include, e.g., batch enzyme suspensions or (adsorbed or covalently) immobilized enzyme bioreactors. In vivo systems include, e.g., immobilized cell bioreactors, continuous fermentations, and batch fermentations. A DAHP synthesis system according to the present invention will include at least one KDPGal aldolase (DgoA) and a source of pyruvate and E4P. A DHQ synthesis system according to the present invention will include at least at least one KDPGal aldolase, a source of pyruvate and E4P, and at least one DHQ synthase (AroB). A DHQ synthase-containing enzymatic pathway or production system according to the present invention offers the additional benefit that, in contrast to the reversible reaction forming DAHP from pyruvate and E4P, the reaction forming DHQ from DAHP is irreversible due to cleavage of the phosphate ester. This can result in increased yields of DHQ and downstream derivatives thereof, e.g., shikimate. The coding sequence of an exemplary aroB gene is the E. coli sequence (SEQ ID NO:7).
Recombinant host cells according to the present invention are capable of expressing at least one recombinant KDPGal aldolase and optionally at least one DHQ synthase or other shikimate pathway enzyme. In a preferred embodiment, the recombinant cell capable of expressing KDPGal aldolase, and optionally of expressing DHQ synthase, will be a walled cell. Examples of walled cells include plant cells, yeast/fungal cells, bacterial cells, Archaea cells, and some protests. In a preferred embodiment, the recombinant cell will be a prokaryotic cell. In a preferred embodiment, the recombinant cell will be a bacterial cell. In a preferred embodiment, the recombinant cell will be a proteobacterial cell. Preferably, the recombinant host cell will lack the ability to express a functional DAHP synthase. In a preferred embodiment, the cell will be an aroFGH − cell.
A DHS synthesis system according to the present invention will include at least at least one KDPGal aldolase, a source of pyruvate and E4P, at least one DHQ synthase, and at least one 3-dehydroquinate dehydratase. A shikimate synthesis system according to the present invention will include at least at least one KDPGal aldolase, a source of pyruvate and E4P, at least one DHQ synthase, at least one 3-dehydroquinate dehydratase, and at least one shikimate dehydrogenase.
EXAMPLES
Materials and Methods
Cloning, Plasmid Construction, Host Cells, and Transformation
Standard protocols can be used for construction, purification, and analysis of plasmid DNA. See, e.g., Sambrook, J.; Fritsch, E. F.; Maniatis, T., “Molecular Cloning—A Laboratory Manual,” Cold Spring Harbor Laboratory: Plainview, N.Y., 1990. In various embodiments, Escherichia coli strain DH5α serve as the host strain for all plasmids constructions. Klebsiella pneumoniae genomic DNA can be purchased from the American Type Culture Collection (ATCC 700721D). E. coli strain CB734 [C600 leu thi1 Δ(gal-aroG-nadA)50 aroF::cat(Cm R ) ΔaroH::Kan R recA1] may be obtained from Professor Ronald Bauerle (University of Virginia). E. coli strain JC7623, BW25141/pKD3 and BW25141/pKD46 may be obtained from the E. coli genetic stock center at Yale University. See, e.g., Lloyd, R. G.; Buckman, C., J. Bacteriol. 1985, 164, 836-844; and. Datsenko, K. A.; Wanner, B. L., Proc. Natl. Acad. Sci. USA 2000, 97, 6640-6645. Taq polymerase, large fragment of DNA polymerase I, calf intestinal alkaline phosphotase and pCR2.1-TOPO vector can be purchased from Invitrogen, Pfu polymerase was purchased from Strategene. DNaseI can be purchased from Roche Diagnostics. L-lactic dehydrogenase was purchased from Sigma. DNA clean and concentrator kit can be purchased from Zymo Research (Orange, Calif.). Phage P1 transduction, transformation with CaCl 2 and PCR amplifications can be performed by standard methods. E. coli genomic DNA can be purified as previously described. See, e.g., Pitcher, D. G.; Saunders, N. A.; Owen, R. J. Lett. Appl. Microbiol. 1989, 8, 151-156. E. coli strains W31105, AB32486, and KL37 and cloning vectors pJF118EH8 and pTrc99A9 can be obtained from the laboratory of Dr. John Frost, Michigan State University.
Escherichia coli dgoA gene sequences can be obtained from the National Center for Biotechnology Information (NCBI). See, e.g., Babbitt, P. C.; Mrachko, G. T.; Hasson, M. S.; Huisman, G. W.; Kolter, R.; Ringe, D.; Petsko, G. A.; Kenyon, G. L.; Gerlt, J. A. Science 1995, 267, 1159-1161 . Klebsiella pneumoniae dgoA gene sequence can be obtained from the Genome Sequencing Center at Washington University using BLAST search against E. coli dgoA gene sequence.
Restriction maps for plasmids among those useful herein are set forth in FIG. 3 . Sites are abbreviated as follows: X=XbaI, B=BamHI, Bg=BglII, E=EcoRI, P=PstI, K=KpnI, M=MfeI, N=NcoI, S=SmaI. Parentheses indicate that the designated enzyme site has been eliminated. Lightface lines indicate vector DNA; Boldface lines indicate insert DNA.
pNR5.223:
The 0.6-kb fragment containing the E. coli dgoA gene and its ribosomal binding site are amplified from E. coli W3110 genomic DNA using Taq polymerase with the following pair of primers containing XbaI recognition sequences, JWF 430 5′-GC TCTAGA TGCAGTGGCAAACTAAACT (SEQ ID NO:13) and JWF 449 3′-GAC TCTAGA TCATTGCACTGCCTCTCGAT (SEQ ID NO:14). The PCR fragment is mixed with pCR2.1TOPO vector to afford the 4.5-kb plasmid pNR5.223.
pNR7.088:
The 0.6-kb fragment containing the E. coli dgoA gene and its ribosomal binding site was amplified from E. coli W3110 genomic DNA using Pfu polymerase with the following pair of primers, JWF 484 5′-GAC GGATCC TATAAGGAGCATCGCTCATG (SEQ ID NO:15), JWF 529 3′-GAAG CTGCAG TCATTGCACTGCCTCTCGAT (SEQ ID NO:16). The PCR primers were designed to include BamHI and PsfI recognition sequences at the 5′ and 3′ ends, respectively of the dgoA gene. Localization of the amplified dgoA as a BamHI-PstI fragment into the corresponding sites of pTrc99A afforded the 4.8-kb plasmid pNR7.088.
pNR7.118:
The 0.6-kb E. coli dgoA locus is excised from pNR7.088 by BamHI and PstI double digestion. Ligation to pJF118EH affords plasmid pNR7.118 in which the E. coli dgoA locus was located downstream the tac promoter.
pNR6.252:
The 5.9-kb plasmid contains K. pneumoniae dgoA gene located behind the tac promoter of pJF118EH. The 0.6-kb dgoA gene with its ribosomal binding site is amplified from Klebsiella pneumoniae subsp. pneumoniae genomic DNA (ATCC 700721 D) using the following primers, JWF 501 5′-GACAGGMTAAGGAGCATCG (SEQ ID NO:17), and JWF 499 5′-GGAGGTAMCGGTACGTGGT (SEQ ID NO:18). The resulting PCR fragment is ligated into pCR2.1TOPO vector by TA TOPO cloning technique to afford pNR6.223B. The 0.6-kb locus is then excised from pNR6.223B by EcoRI digestion and ligated to the EcoRI site of pJF118EH to afford plasmid pNR6.252.
pNR7.126:
The 6.4-kb plasmid is constructed by ligating the aroF FBR (“aroF Feedback-Resistant”) gene with its ribosomal binding site into the EcoRI site of pJF118EH. The aroF FBR fragment is amplified by PCR from pKD12.112 using the following primers containing EcoRI terminal recognition sequence, JWF541 5′-G GAATTC GCATAAACAGGATCGCCATCA (SEQ ID NO:19) and JWF542 5′-CT GGATCC TTAAGCCACGCGAGCCGT (SEQ ID NO:20). See Draths, K. M. et al., J. Am. Chem. Soc., 1999, 121, 1603-04.
pNR7.288:
The 0.8-kb cat gene is excised from pSU18 by digestion with BamHI, then is inserted into the BglII site internal to the aroF FBR gene in pKD12.112 to produce plasmid pNR7.288.
pNR7.297:
The 1.3-kb fragment containing aroG gene is amplified from E. coli W3110 genomic DNA using the following primers containing BamHI terminal recognition sequence, JWF 610 5′-GT GGATCC TTAATCCGTTCATAGTGTMA (SEQ ID NO:21), and JWF 611, 5′-TG GGATCC ATGAGAAAGCCGACTGCAA (SEQ ID NO:22). The PCR fragment is ligated into pSU18 vector to create pNR7.260. Ligation of a SspI/AvaI digested tet-encoding fragment of DNA obtained from plasmid vector pBR322 into the MfeI site internal to the aroG gene in pNR7.260 resulted in plasmid pNR7.297.
pNR7.290:
The 1.3-kb fragment containing aroH gene is amplified from E. coli W3110 genomic DNA using the following primers JWF-625, 5′-GTTCGTCAGTGCAGGATGGA (SEQ ID NO:23) and JWF-626, 5′-GTTCAGGCGTGAGTTTTCTGCT (SEQ ID NO:24). The PCR product is initially cloned into plasmid vector pCR2.1-TOPO, then the fragment containing aroH is digested with HindIII/XbaI and inserted into the HindIII/XbaI site of plasmid pTrc99A to afford a 5.5-kb plasmid pNR7.289B. A 1.3-kb Kan R gene excised from plasmid pKAD62A by digestion of PstI is cloned into the PstI site internal to the aroH gene in pNR7.289B to yield plasmid pNR7.290.
pNR8.074:
The 1.6-kb serA gene is excised from plasmid pRC1.55B by SmaI digestion. Ligation of serA gene to plasmid pNR6.252 predigested with HindIII to afford the 7.5-kb plasmid pNR8.074.
pNR8.075:
The 1.6-kb serA gene is excised from plasmid pRC1.55B by SmaI digestion. Ligation of serA gene to plasmid pNR7.088 predigested with HindIII afforded the 6.8-kb plasmid pNR8.075.
Construction of aroFaroGaroH Triple Mutant Strain NR7:
Disruption of aroF, aroG and aroH genes in E. coli KL3 is done as follows. Plasmid pNR7.288 is digested with EcoRI to liberate the insertionally inactivated E. coli aroF gene. The purified fragment (aroF::cat) is electroporated into the hyper-recombinant E. coli strain JC7623. Chloroamphenicol resistant colonies are picked up from LB plate containing 20 μg/mL chloroamphenicol, and the genotype verified by size analysis of the DNA fragment amplified by PCR from chromosomal DNA using the following primers JWF-541, 5′-GGMTTCGCATAAACAGGATCGCCATCA (SEQ ID NO:25), and JWF-542, 5′-CTGGATCCTTAAGCCACGCGAGCCGT (SEQ ID NO:26). The aroF::cat mutation is then transferred from JC7623aroF::cat to E. coli KL3 by phage P1-mediated transduction to prepare KL3aroF::cat.
Similarly, the fragment comprising aroH::Kan R is excised from plasmid pNR7.290 by digestion with XbaI and HindIII, then electroporated into JC7623. The JC7623aroH::Kan R mutants resulting from homologous recombination are resistant to 50 μg/mL kanamycin. The correct genotype is verified by PCR analysis from chromosomal DNA using the following primers JWF-636, 5′-TCCGTACTGCGCGTATTGAGA (SEQ ID NO:27) and JWF-637, 5′-AGAGGCGAGTTTTTCGACCA (SEQ ID NO:28). P1 phage mediated transduction employed to transfer the aroH::Kan R mutation into KL3aroF::cat and produce NR3 [KL3aroF::cat aroH::Kan R ].
The aroG mutation is generated by the methods described by Datsenko and Wanner. See, Datsenko, K. A.; Wanner, B. L. Proc. Natl. Acad. Sci. USA 2000, 97, 6640-6645. Plasmid pNR7.297 is digested with KpnI and PstI to liberate a fragment containing aroG::tet cassette, the purified DNA is electroporated into NR3/pKD46 while expressing Red recombinase. Recombinants are selected for tetracycline resistance (5 μg/mL). Plasmid pKD46 are eliminated by growth at 42° C. Disruption of aroG is confirmed by PCR analysis using the following primers JWF-669, 5′-GCAGCATTGTGCCGCCAGAA (SEQ ID NO:29) and JWF-670, 5′-GTGCGCTGGTGAAATATCTT (SEQ ID NO:30). The KL3aroF::cat aroG::tet aroH::Kan R strain is designated herein as E. coli NR7.
Enzyme Assay
The cells are suspended in KH 2 PO 4 (20 mM, pH 6.5) containing PMSF (1 Mm; phenyl methyl sulfonyl fluoride). Cell lysis is achieved by two passes through a French pressure cell (SLC Aminco) at 16000 psi (110.3 MPa). Cell debris is separated from lysate by centrifugation at 48000 g for 20 min at 4° C. Protein concentration is quantified using the Bradford dye-binding procedure with the assay solution purchased from Bio-Rad. See Bradford, M. M., Anal. Biochem., 1976, 72, 248-54.
KDPGal Cleavage Assay
KDPGal aldolase activity is determined using a coupled enzyme assay previously described by Meloche: Meloche, H. P., Wood, W. A., J. Biol. Chem., 1964, 239, 3515-18. 2-keto-3-deoxy-6-phosphogalactonate (KDPGal) was prepared following the method of Toone: Toone, E. J. et al., J. Mol. Catal. B - Enzymatic, 1998, 5, 103-11. To a 1 mL quartz cuvette were added 954 μL KH 2 PO 4 buffer (20 mM, pH 7.5), 10 μL NADH (35 mM), 10 μL L-lactic dehydrogenase (L-LDH, EC 1.1.1.27, type II, rabbit muscle, 1 U/μL) and 10 μL appropriately diluted cellular lysate (1:10 to 1:50 dilution in 20 mM KH 2 PO 4 , pH 7.5). The solution is mixed and pre-incubated for 2 min at room temperature. The reaction is initiated by addition of KDPGal (16 μL, 100 mg/mL, Li + salt). The absorbance at 340 nm is recorded continuously for 1 min. One unit of KDPGal aldolase activity is defined by the catalyzed loss of one μmol of NADH per minute.
DAHP Formation Assay
Enzyme activity is measured by following the formation of 3-dehydroshikimic acid (DHS) over time when DHQ synthase (3-dehydroquinate synthase, E.C. 4.2.3.4) and DHQ dehydratase (E.C. 4.2.1.10) are utilized as coupling enzymes. DHQ synthase is prepared as described in Frost, J. W. et al., Biochemistry, 1984, 23, 4470-75; DHQ dehydratase is purified from E. coil AB2848/pKD201 The reaction (1 mL) contains 50 mM morpholinepropanesulfonic acid (MOPS) buffer (pH 7.5), 1 mM D-erythrose 4-phosphate, 1 mM pyruvate, 50 μM CoCl 2 , 10 μM NAD, 1 U of DHQ synthase, 1 U of DHQ dehydratase and cellular lysate. The reaction is initiated by addition of diluted cellular lysate to the assay solution, and the absorbance at 234 nm monitored continuously for 5 min. One unit of evolved enzyme activity is defined by the formation of one μmol of DHS per minute.
Error-Prone PCR
Random mutagenesis of dgoA gene is conducted using methods described by Cadwell and Joyce: Cadwell, R. C., Joyce, G. F., PCR Meth. Appl., 1992, 2, 28-33. PCR is performed in a 100 μL reaction mixture containing 10 ng of dgoA fragment as template, 20 mM Tris-HCl, pH 8.4, 50 mM KCl, 7 mM MgCl 2 , 0.5 mM MnCl 2 , 0.2 mM dATP, 0.2 mM dGTP, 1.0 mM dCTP, 1.0 mM dTTP, 50 μmol of each primer and 5 U Tag polymerase (Invitrogen). Conditions for PCR are as follows: one cycle of 4 min at 94° C., 22 cycles of 45 sec 94° C., 45 sec 45° C., 45 sec 72° C.; and one cycle of 10 min 25° C.
DNA Shuffling
DNA shuffling is performed following the protocol of Stemmer modified by Zhao and Arnold. See, Stemmer, W. P. C. Proc. Natl. Acad. Sci. USA 1994, 91, 10747-10751; Stemmer, W. P. C. Nature 1994, 370, 389-391; and Zhao, H.; Arnold, F. H. Nucleic Acids Res. 1997, 25, 1307-1308. The 0.6-kb dgoA gene of interest is amplified using Pfu polymerase under standard PCR conditions and cleaned through DNA Clean and Concentrator kit. Fragments for shuffling are created by digesting the cleaned PCR product with DNaseI in a 50 μL reaction containing 5 μg DNA, 50 mM Tris-HCl, pH 8.0, 10 mM MnCl 2 , and 0.05 U of DNaseI for 10 min at 15° C. The reaction is stopped with addition of 15 μL EDTA (100 mM, pH 8.0) and 12 μL Endostop. Fragments of 20 to 80 bps are purified from 2.0% low melting point agarose gel (Invitrogen) using DE81 ion-exchange paper (Whatman). The purified DNA fragment are dissolved into 30 μL sterile water.
The fragments are reassembled by PCR without primers in a 50 μL reaction containing 20 mM Tris-HCl, pH 8.4, 50 mM KCl, 2 mM MgCl 2 , 200 μM each dNTPs, 10 μL of DE81 purified DNA fragments and 2.5 U of Taq polymerase. PCR is conducted as follows: 1 min 94° C. followed by 45 cycles of 30 sec 94° C., 30 sec 50° C., 30 sec 72° C., followed by 5 min 72° C. and 5 min 25° C.
The 0.6-kb dgoA genes are reassembled by PCR with forward and reverse primers in a 100 μL reaction containing 5 μL of reassembled DNA, 20 mM Tris-HCl, pH 8.4, 50 mM KCl, 2 mM MgCl 2 , 200 μM each dNTPs, 50 μmol primers and 5 U of Taq polymerase.
Selection Medium for Directed Evolution of KDPGal Aldolases
Selection medium comprises Na 2 HPO 4 (6 g/L), KH 2 PO 4 (3 g/L), NH 4 Cl (1 g/L), NaCl (0.5 g/L), glucose (4 g/L), MgSO 4 (0.12 g/L), thiamine (6 mg/L), L-leucine (25 mg/L), nicotinic acid (6 mg/L). IPTG is added to a final concentration of 0.2 mM or 0.05 mM. L-Phenylalanine (40 mg/L), L-tyrosine (40 mg/L) and L-tryptophan (40 mg/L) are added as indicated. Solid medium is prepared by addition of 1.5% (w/v) Difco agar to medium solution.
Specific Example 1
Purification of KDPGal Aldolase from E. coli and In-Vitro Biosynthesis of 3-Dehydroshikimate
E. coli AB3248/pNR5.223 is grown in LB medium containing 50 μg/mL ampicillin at 37° C. IPTG (isopropyl-beta-D-thiogalactopyranoside) is added to a final concentration of 0.2 mM when OD600 reached 0.5. The cells are grown for an additional 6 h, and pelleted by centrifugation (4200 g, 10 min). The cells are washed with 0.9% NaCl solution once and suspended in 20 mM KH 2 PO 4 , pH 6.5 with 1 mM PMSF. Disruption of the cells is achieved by two passages through a French pressure cell (16000 psi; 110.3 MPa). Cell debris is removed by centrifugation at 48000 g for 20 min. The resulting crude cell-free lysate is first treated with protamine sulfate and solid (NH 4 ) 2 SO 4 , then applied to a DEAE-cellulose (Whatman) column. The column is washed with a gradient mixture of buffer B (20 mM KH 2 PO 4 , 50 mM KCl, pH 7.5) and buffer C (20 mM KH 2 PO 4 , 400 mM KCl, pH 7.5). Fractions containing KDPGal aldolase are concentrated, dialyzed, quick frozen in liquid nitrogen and stored at −80° C. (87 units/mg).
D-Erythrose 4-phosphate (0.45 mL, 12 mM, pH 7.0), sodium pyruvate (0.054 mL, 100 mM, pH 7.0), CoCl 2 (0.027 mL, 10 mM), NAD (0.054 mL, 1 mM), DHQ synthase (2 units) and DHQ dehydratase (2 units) are incubated with KDPGal aldolase (100 units) from E. coli at room temperature for 2 h. Protein is subsequently removed by ultrafiltration using Millipore PM-10 membrane. 3-Dehydroshikimate was formed in 90% yield, as determined by 1 H NMR analysis.
Specific Example 2
Cloning and Characterization of dgoA Genes from Other Bacterial Sources.
E. coli wild-type dgoA-encoded KDPGal aldolase showed weak activity toward accepting D-erythrose 4-phosphate as a substrate. KDPGal aldolases from other bacterial sources might have higher activities for catalyzing the condensation of pyruvate with D-erythrose 4-phosphate. Obtaining dgoA genes from other bacteria would also enable a cross-species DNA family shuffling that has been reported to improve enzyme performance rapidly. Although KDPGal aldolase activities have been identified in Pseudomonas saccarophila, Pseudomonas cepacia, Caulobacter cresentus, Azotobacter vinelandii, Rhizobium meliloti, Gluconobacter liquefaciens , and nonpathogenic Mycobacteria , none of these dgoA gene sequences was known except in Caulobacter cresentus in which the genomic sequence has been obtained. See: Crameri, A. et al., Nature 1998, 391, 288-291; Kurn, N. et al., J. Bacteriol. 1978, 135, 517-520; Wong, T. Y.; Yao, X., Appl. Environ. Microbiol. 1994, 60, 2065-2068; Arias, A.; Cervenansky, C., J. Bacteriol. 1986, 167, 1092-1094; Stouthammer, A. H., Biochim. Biophys. Acta 1961, 48, 484-500; Szumilo, T., Mycobacteria . J. Bacteriol. 1981, 148, 368-370; and Nierman, W. C. et al., Proc. Natl. Acad. Sci. USA 2001, 98, 4136-4141.
Performing a BLAST (Basic Local Alignment Search Tool) search against E. coli dgoA nucleotides sequence in microbial genome database only yielded two possible dgoA sequences from Klebsiella pneumoniae and Salmonella typhimurium LT2. BLAST search against the E. coli dgoA protein sequence afforded several more hits including Caulobacter cresentus CB15, Agrobacterium tumefaciens, Ralstonia solanacearum, Bradyrhizobium japonicum, Brucella melitensis and Sinorhizobium meliloti . The genomic DNA of K. pneumoniae, S. typhimurium LT2 (ATCC 15277), A. tumefaciens (ATCC 17805) and C. cresentus CB15 (ATCC 19089) are readily available from the American Type Culture Collection (ATCC). Thus, the open reading frames of the K. pneumoniae, S. typhimurium LT2, A. tumefaciens and C. cresentus CB15 dgoA genes were amplified from their respective genomic DNA using PCR and cloned into a medium copy number expression vector pJF118EH with transcription under the control of a P tac promoter to prepare plasmid pNR6.252, pNR7.120, pNR6.300 and pNR7.063, respectively. The native start codon of GTG in C. cresentus dgoA was changed into an ATG start codon in plasmid pNR7.063. The corresponding plasmids were transformed into E. coli CB734, and in all cases, the KDPGal aldolase activities in crude cell lysates were confirmed and determined (Table 1).





TABLE 1



KDPGal Aldolases from Various Microorganisms.








dgoA





size
Identity a with
KDPGal
DAHP

dgoA source
(nt)
E. coli dgoA
cleavage b
formation b










Escherichia coli
c

618
100%
7.6
0.068


Klebsiella pneumoniae
d

618
82%
77
0.29


Salmonella typhimurium
e

618
81%
10
0.080


Agrobacterium

630
54%
4.8
0.30


tumefaciens
f



Caulobacter cresentus
g

582
60%
3.6
0.23



a Identity is calculated based on nucleotide sequence using the global sequence alignment provided by Biology Workbench (http://workbench.sdsc.edu); see Pearson, W. R.; Lipman, D. J., Improved tools for biological sequence comparison, Proc. Natl. Acad. Sci. USA 1988, 85, 2444-2448, and Pearson, W. R., Rapid and sensitive sequence comparison with FASTP and FASTA, Methods Enzymol. 1990, 83, 63-98.

b Specific activity is defined as units of enzyme activity per mg of protein in crude cell lysate. One unit of activity = one μmol of KDPGal cleaved or DAHP formed per minute.

c E. coli CB734/pNR7.088.

d E. coli CB734/pNR6.252.

e E. coli CB734/pNR7.120.

f E. coli CB734/pNR6.300.

g E. coli CB734/pNR7.063.




































All of the bacteria identified in the BLAST searches are members of the proteobacteria. Thus, in a preferred embodiment of a recombinant KDPGal aldolase according to the present invention, the amino acid sequence of the recombinant will be a variant of the amino acid sequence of a native (i.e. wild-type) KDPGal aldolase obtained from a member of the bacteria; in a preferred embodiment, it will be obtained from a member of the proteobacteria. In methods and pathways according to the present invention, the KDPGal aldolase(s) used therein may have either a native or a mutant KDPGal aldolase amino acid sequence. Where a native KDPGal aldolase amino acid sequence is utilized, in a preferred embodiment, it will be obtained from a member of the bacteria; in a preferred embodiment, it will be obtained from a member of the proteobacteria. In a preferred embodiment, a bacterium providing such a native amino acid sequence will be a member of any one of the genera Escherichia, Klebsiella, Salmonella, Caulobacter, Agrobacterium, Ralstonia, Bradyrhizobium, Brucella , and Sinorhizobium.
The KDPGal aldolases of E. coli (SEQ ID NO:2), K. pneumoniae (SEQ ID NO:4), and S. typhimurium (SEQ ID NO:6), were all found to be 205 residues in length. The remaining KDPGal aldolases identified from BLAST analyses of genomic DNA, were found to range from 194 to 213 residues in length. In a preferred embodiment, a KDPGal aldolase according to the present invention will be about 190 to about 215 residues; in a preferred embodiment, it will be about 200 to about 210 residues; and in a preferred embodiment, it will be about 205 residues in length.
Among the five KDPGal aldolases, K. pneumoniae and A. tumefaciens KDPGal aldolases showed highest activities toward DAHP formation (see Table 1). The dgoA gene coding sequences of K. pneumoniae (SEQ ID NO:3) and S. typhimurium LT2 (SEQ ID NO:5) were found to have the highest nucleotide sequence homology of about 81% with that of the E. coli dgoA (SEQ ID NO:1) (see Table 1).
Specific Example 3
Directed Evolution of KDPGal Aldolases
The dgoA genes of E. coli, K. pneumoniae , and S. typhimurium were each evolved by use of error-prone PCR and DNA shuffling. E. coli dgoA and K. pneumoniae dgoA and were subjected to two rounds of error-prone PCR mutagenesis followed by one round of DNA shuffling. Identification of increased activity relative to condensation of pyruvate with D-erythrose 4-phosphate was based on a selection that increased in stringency with each round of directed evolution.
The activity of the resulting KDPGal aldolases in catalyzing condensation of pyruvate and D-erythrose 4-phosphate was investigated in E. coli CB734, which lacks all isozymes of DAHP synthase. Thus, growth of E. coli CB734 on glucose-containing minimal salts medium required supplementation with L-phenylalanine, L-tyrosine, L-tryptophan and aromatic vitamins (entry 1, Tables 2-4, below).





TABLE 2



Directed Evolution of E. coli KDPGal aldolase.










Entry
Construct a
M9 b
M9 c
F d
YF d
YFW d
YFWvit d



1
E. coli CB734
− e
−
−
−
−
+ f

2
CB734/pNR7.088
−
−
−
−
+
+

3
CB734/pEC01
−
−
−
+
+
+

4
CB734/pEC02
−
+
+
+
+
+

5
CB734/pEC03
+
+
+
+
+
+



a All native and evolved dgoA genes were inserted into the same plasmid (pTrc99A) with transcription controlled by a Ptrc promoter.

b Contained L-leucine and 0.05 mM IPTG.

c Contained L-leucine and 0.2 mM IPTG.

d Supplements added to M9 medium containing L-leucine and 0.2 mM IPTG included: F, L-phenylalanine; Y, L-tyrosine; W, L-tryptophan; vit, p-aminobenzoate, p-hydroxybenzoate, 2,3-dihydroxybenzoate.

e no growth (−).

f growth (+).


































TABLE 3



Directed Evolution of K. pneumoniae KDPGal Aldolase










Entry
Construct e
M9 a
M9 b
F c
YF c
YFW c
YFWvit c



1
E. coli CB734
− d
−
−
−
−
+ e

2
CB734/pNR7.118
−
−
−
−
+
+

3
CB734/pNR6.252
−
−
−
+
+
+

4
CB734/pKP01
−
−
+
+
+
+

5
CB734/pKP02
−
+
+
+
+
+

6
CB734/pKP03
+
+
+
+
+
+



a contained 0.05 mM IPTG.

b contained 0.2 mM IPTG.

c Supplements added to M9 medium containing 0.2 mM IPTG included: F, L-phenylalanine; Y, L-tyrosine; W, L-tryptophan; vit, p-aminobenzoate, p-hydroxybenzoate, 2,3-dihydroxybenzoate.

d growth (+).

e no growth (−).

e All native and evolved dgoA genes were inserted into the same plasmid (pJF118EH) with transcription controlled by a Ptac promoter.



































TABLE 4



Directed Evolution of S. typhimurium KDPGal Aldolase










Entry
Construct a
M9 b
M9 c
F d
YF d
YFW d
YFWvit d



1
E. coli CB734
− e
−
−
−
−
+ f

2
CB734/pNR7.120
−
−
−
−
+
+

3
CB734/pST01
−
−
−
+
+
+

4
CB734/pST02
−
−
+
+
+
+

5
CB734/pST03
−
+
+
+
+
+

6
CB734/pST04
+
+
+
+
+
+



a All native and evolved dgoA genes were inserted into the same plasmid (pJF118EH) with transcription controlled by a P tac promoter.

b Contained L-leucine and 0.05 mM IPTG.

c Contained L-leucine and 0.2 mM IPTG.

d Supplements added to M9 medium containing L-leucine and 0.2 mM IPTG included: F, L-phenylalanine; Y, L-tyrosine; W, L-tryptophan; vit, p-aminobenzoate, p-hydroxybenzoate, 2,3-dihydroxybenzoate.

e no growth (−).

f growth (+).






























It was also found that E. coli CB734/pNR7.118 with its mid-encoded E. coli DgoA was able to biosynthesize its own aromatic ins (entry 2, Table 3). Plasmid-encoded K. pneumoniae DgoA afforded old higher KDPGal aldolase specific activity in E. coli CB734/pNR6.252 relative to plasmid-encoded E. coli DgoA in E. coli CB734/pN7.118. E. coli CB734/pNR6.252 was able to provide for its own aromatic vitamin and L-tryptophan requirements (entry 3, Table 3).
A. Evolution of KDPGal Aldolase from E. coli
The dgoA gene encoding the native E. coli KDPGal aldolase is amplified under mutagenic (error-prone) PCR condition with the following primers, JWF 484 5′-GACGGATCCTATAAGGAGCATCGCTCATG (SEQ ID NO:33), JWF 529 3′-GAAGCTGCAGTCATTGCACTGCCTCTCGAT (SEQ ID NO:34). The 0.6-kb E. coli dgoA amplification product is purified, digested with restriction enzymes BamHI and PstI. The fragments are cloned into the corresponding sites of pTrc99A and transformed into competent CB734 cells by electroporation to generate the first generation plasmid library. After transformation, a library of 1×10 6 colonies are spread on minimal salts plates supplement with tyrosine and phenylalanine with 0.2 mM IPTG. After incubation at 37° C. for 3 days, 50 large colonies were picked up and a plasmid mixture (pEC01-mix) are prepared. For the second round of selection, the mutant 0.6-kb dgoA gene is isolated and further amplified under mutagenic PCR condition, the fragments are cloned into pTrc99A vector. A library of 1×10 6 colonies is spread on minimal salts plates with 0.2 mM IPTG without any aromatic amino acids supplementation. More than 100 colonies are produced after 4 days of incubation, 50 large colonies replicated on a LB/Ap plate. After overnight incubation, the cells are scraped from the plate with sterile water and a plasmids mixture was prepared (pEC02-mix). For the third round, the 0.6-kb fragments encoding the mutant DgoA are PCR amplified from the pEC0 2 -mix, the fragments aer shuffled to combine the beneficial point mutations and cloned into pTrc99A as above. A library of 3×10 5 colonies are spread on minimal salts plates with 0.05 mM IPTG. After 3 days at 37° C., 7 largest colonies are picked up for characterization. See Table 5, below.
TABLE 5 Mutations and Specific Activities of E. coli KDPGal Aldolase Variants DAHP formation sp. activity a DgoA Mutations (U/mg) Wild-type 0.086 EC03-1 F33I, D58N, Q72H, A75V, V85A, V154F 0.56 EC03-2 D30G, F33I, D34G, S42T, A75T, V85A, 0.30 V154F, L179I, A182P EC03-3 F33I, D34G, K59R, V85A, A111P, G134S, 0.56 P135L, V154F, P159A EC03-4 F33I, D34G, S42T, D74N, V85A, A122V, 0.32 V154F, D167E, A190T EC03-5 S42T, K59M, V85A, A122V, V154F, D178V 0.37 EC03-6 S42T, V85A, H90Y, V154F, L175I 0.32 EC03-7 K6N, T17M, V85A, I89T, V154F, S185P 0.29 a E. coli CB734 was used as host strain for expression of the evolved enzymes.
B. Evolution of KDPGal Aldolase from K. pneumoniae
K. pneumoniae dgoA is amplified under mutagenic PCR conditions with the following primers, JWF559 5′-GGMTTCGACAGGMTAAGGAGCATCG (SEQ ID NO:31) and JWF560 5′-GACGGATCCTCATTTCACTGCCTCTCGAT (SEQ ID NO:32). The 0.6-kb amplification product is purified through DNA Clean and Concentrator kit, followed by double digestion with restriction enzymes EcoRI and BamHI, and cloned into the EcoRI-BamHI restriction site of expression vector pJF118EH to generate the first generation plasmid library. The plasmid library is electroporated into CB734 and a library of 1×10 6 colonies are plated out on minimal salts plates with phenylalanine and 0.2 mM IPTG supplementation. L-Leucine is added throughout the selection since CB734 is also a leucine-auxotrophy strain. A single colony is produced after 48 h incubation at 37° C., and the plasmid carrying the first generation mutant KP01-1 prepared from the colony. For the second generation, KP01-1 is amplified under mutagenic PCR conditions and cloned as above. A library of 6×10 5 colonies are spread on minimal salts plates with 0.2 mM IPTG and no aromatic amino acids supplementation. After 4 days incubation at 37° C., 50 largest colonies were picked up and a mixture of the plasmid was prepared. For the third round, the mutated dgoA genes KP02 were fragmented and shuffled to combine beneficial point mutations and subsequent cloned and transformed as before. A library of 3×10 4 colonies are spread on minimal salts plates with 0.05 mM IPTG. After 3 days at 37° C., 7 largest colonies were picked up for characterization. See Table 6 below.
TABLE 6 Mutations and Specific Activities of K. pneumoniae KDPGal Aldolase Variants DAHP formation sp. activity a DgoA Mutations (U/mg) Wild-type 0.29 KP03-1 I10V, V85A, V154F, E187D, F196I 0.80 KP03-2 I10V, P70L, V85A, P106S, V154F, 0.15 S185L, F196I KP03-3 I10V, E71G, V85A, P106S, V154F, 1.30 E187D, Q191H, F196I KP03-4 I10V, V85A, V154F, A195T, F196I 0.51 KP03-5 I10V, I16V, P70L, V85A, R96Q, P106S, 0.049 V154F, F196I KP03-6 I10V, V85A, V154F, F196I 0.66 KP03-7 I10V, V85A, P106S, V154F, F196I 0.65 a E. coli CB734 was used as host strain for expression of the evolved enzymes.
C. Evolution of KDPGal Aldolase from S. typhimurium.
S. typhimurium dgoA was subjected two rounds of error-prone PCR mutagenesis and two rounds of DNA shuffling. The plasmid library from the first round of error-prone PCR mutagenesis was electroporated into E. coli CB734 and plated out onto minimal salts plates containing L-tyrosine, L-phenylalanine and 0.2 mM IPTG. E. coli CB734/pST01 (entry 3, Table 4) colonies resulted from the first round of PCR mutagenesis performed using wild-type S. typhimurium dgoA as template only required L-tyrosine and L-phenylalanine supplementation for growth. The second round of PCR mutagenesis gave E. coli CB734/pST02 colonies (entry 4, Table 4) whose growth required only L-phenylalanine supplementation. The third round of mutagenesis involving shuffling gave E. coli CB734/pST03 colonies that grew in the absence of aromatic amino acids supplements (entry 5, Table 4). The fourth round of mutagenesis involving shuffling gave CB734/pST04 colonies that grew in minimal salts medium without aromatic amino acids supplementation at reduced KDPGal aldolase expression level by lowering IPTG concentration (entry 6, Table 4). The dgoA gene variants from seven largest colonies after the final round of selection were sequenced and their encoding KDPGal aldolase activities toward DAHP formation were characterized (Table 7). All seven evolved KDPGal aldolase showed higher activity toward DAHP formation activity as compared to the wild-type S. typhimurium KDPGal aldolase. The most active mutant ST04-5 showed a 15-fold increase in activity.
TABLE 7 Mutations and Specific Activities of S. typhimuriume KDPGal Aldolase Variants. DAHP activity a DgoA Mutations (U b /mg) Wild-type 0.080 ST04-1 V28L, S42T, S50P, P150L, L175S 0.48 ST04-2 V28M, S42T, S50P, P150L, D178G, N198K 0.85 ST04-3 D20E, V28L, S42T, L175S 0.84 ST04-4 V28M, S42T, Q123R, T158M, N161D, D178G 0.54 ST04-5 D20E, V28M, S42T, I89T, P150L, D178G 1.24 ST04-6 V28M, S42T, S50P, Q164A, L175S, N198K 0.42 ST04-7 V28L, S42T, P91Q, P150L, T158M, D178G, 1.04 N198K a E. coli CB734 was used as host strain for expression of evolved enzymes. b One unit of DAHP synthase catalyzes the formation of one μmol of 3-dehydroshikimate per minute at 25° C.
D. Characterization of E. coli, K. pneumoniae and S. typhimurium DgoA Mutants

After directed evolution, a total of twenty-one active mutants selected from the E. coli, K. pneumoniae and S. typhimurium DgoA mutants were further characterized. Each mutant contained 4-9 amino acids substitutions. No insertion or deletion mutants were found. Two amino acids substitutions (V85A, V154F) were observed in all of the seven most active K. pneumoniae DgoA and seven most active E. coli dgoA mutants. However, these two mutations were not found in any of the seven most active S. typhimurium mutants. Instead, all seven of the most active S. typhimurium mutants contained a S42T substitution, as did four of the seven most active E. coli mutants. EC03-1, the most active evolved E. coli KDPGal aldolase, exhibited an 8-fold higher DAHP formation specific activity and a 7-fold reduced KDPGal cleavage specific activity relative to the native E. coli KDPGal aldolase (entry 2, Table 8). KPO3-3, the most active evolved K. pneumoniae KDPGal aldolase, showed a 4-fold higher DAHP formation specific activity and a 30-fold reduced KDPGal cleavage specific activity relative to native K. pneumoniae KDPGal aldolase (entry 4, Table 8). ST04-5, the most active evolved S. typhimurium KDPGal aldolase, exhibited a 15-fold higher DAHP formation specific activity and a 2-fold reduced KDPGal cleavage specific activity relative to wild-type S. typhimurium KDPGal aldolase (entry 6, Table 8).





TABLE 8



Specific Activities of Wild-Type and Evolved KDPGal Aldolase

Isozymes.








DAHP assay a
KDPGal assay a


Enzyme
(U/mg)
(U/mg)










E. coli DgoA b
0.068
6.7


EC03-1 c
0.56
1.0


K. pneumoniae DgoA d
0.29
77


KP03-3 e
1.30
2.6


S. typhimurium DgoA f
0.080
11


ST04-5 g
1.24
4.8





a Specific activity is defined as units of enzyme activity per mg of protein in crude cell lysates. One unit of activity = one μmol of KDPGal cleaved or DAHP formed per minute. Crude cell lysates were prepared from


b E. coli CB734/pNR7.088;


c E. coli CB734/pEC03-1;


d E. coli CB734/pNR6.252;


e E. coli CB734/pKP03-3;


f E. coli CB734/pNR7.120;


g E. coli CB734/pST04-5.




































In addition to V85A and Vi 54F, two other amino acid substitutions (I10V, F196I) were found in all seven of the most active K. pneumoniae mutants. Only one substitution was found in all seven of the most active S. typhimurium mutants; however, a conservative substitution at V28 (either V28M or V28L) was also found in all seven mutants. One amino acid substitution (P70L) was observed solely in the two active K. pneumoniae mutants identified as exhibiting less activity than wild-type K. pneumoniae DgoA; however, these two mutants still exhibited significant aldolase activity, with one of them (KP03-2) exhibiting greater DAHP formation activity than either of the E. coli or S. typhimurium wild type enzymes.
In sum, the following amino acid mutations were identified as being associated with improved mutants of the E. coli, K. pneumoniae , and S. typhimurium DgoA enzymes: X10V, X28L or X28M, X42T, X85A, X154F, and X196I (“X” representing any amino acid residue at that position), more specifically, I10V, V28L or V28M, S42T, V85A, V154F, and F196I. Thus, in a preferred embodiment of a recombinant KDPGal aldolase according to the present invention, the KDPGal aldolase will contain at least one of said mutations. Likewise, the following amino acid mutation was identified as being associated with impaired, though active, mutants of the K. pneumoniae enzyme: X70L, more specifically, P70L. Thus, in a preferred embodiment of a recombinant KDPGal aldolase according to the present invention, the KDPGal aldolase will contain no mutation that is X70L.
The mutations were characterized at the DNA level as follows, with nucleotide substitutions and codon substitutions shown in parentheses:
I10V (a28g; atc28-30gtc); V28M (g82a; gtg82-84atg); V28L (g82t; gtg82-84ttg); S42T (t124a; tcc124-126acc); V85A (t254c; gtt253-255gct); V154F (g460t; gtt460-462ttt); and F196I (t586a; ttc586-588atc).
Specific Example 5
DgoA Family Shuffling
Family shuffling of all five dgoA genes constitutes one option for improving DAHP formation activity. However, a major limitation cited for family shuffling of homologous genes is its reliance on PCR-based assembly of short random fragments generated from homologous genes. This demands a level of sequence identity of more than 70% and 10-15 bp stretches of continuous sequence identity between sequences in order for recombination to occur. Therefore, only K. pneumoniae and S. typhimurium LT2 KDPGal aldolase were subjected to directed evolution by PCR mutagenesis and DNA shuffling, followed by DNA family shuffling of the most evolved K. pneumoniae (KP03-3) and S. typhimurium (ST04-5) KDPGal aldolase mutants with the most evolved E. coli KDPGal aldolase mutant (EC03-1).
The dgoA mutants, EC03-1, KP03-3 and ST04-5, were subjected to DNA family shuffling using the single-stranded DNA shuffling method developed by Zhao and coworkers: Zha, W; Zhu, T; Zhao, H., Methods Mol. Biol. 2003, 231, 91-97. Sequencing a small library of mutants (76) obtained from the family shuffling revealed a crossover rate of approximately 1.4 per gene using the published protocol. E. coli CB734 was transformed with a plasmid library that contained the chimeric dgoA hybrids (NR8.165), and the colonies that showed higher growth rate in the absence of aromatic amino acids supplementation as compared to E. coli CB734 carrying plasmid containing the parent gene, EC03-1, KP03-3 or ST04-5 (colonies appeared after 3 days on minimal salts medium) were selected. The dgoA gene hybrids from the five largest colonies that appeared after 2.5 days were sequenced and their encoding KDPGal aldolase activities toward DAHP formation were determined as shown in Table 9.





TABLE 9



Chimeric dgoA Genes Evolved by Cross-Species DNA Family Shuffling.







family shuffling

DAHP formation b

entry
mutants
dgoA structure a
(U c /mg)



1
NR8.165-2

1.31

2
NR8.165-3

0.30

3
NR8.165-4

0.22

4
NR8.165-5

0.10

5
NR8.165-6

0.56



a Symbol: EC03-1; KP03-3; ST04-5.

b Each dgoA mutant was inserted into the same plasmid (pJF118EH) with transcription controlled by a P tac promoter. E. coli CB734 was used as host strain for expression of evolved enzymes.

c One unit of DAHP synthase catalyzes the formation of one μmol of 3-dehydroshikimate per minute at 25° C.



























All five mutants were found to be chimeras of genes from the E. coli, K. pneumoniae and S. typhimurium . Four of them contain two segments resulting from a single crossover event. One mutant, NR8.165-4, contains three segments resulting from two crossovers. It also noteworthy that most crossover events occurred in the first 40-80 base pairs area where the three genes have 40-base pairs of nearly identical sequences. Compared with the wild-type E. coli KDPGal aldolase, the DgoA mutant NR8.165-4 has a 5-fold increase in k cat and a 5-fold reduction in K m for D-erythrose 4-phosphate, and thus a 25-fold increase in k cat /K m (entry 7, Table 10). Both the mutant NR8.165-2 and NR8.165-6 show a decrease in k cat /K m values relative to their parent enzymes (entries 6 and 8 vs. entries 4 and 5, Table 9). The K m value ranging from 80 to 157 μM for D-erythrose 4-phosphate of the mutant enzymes is close to the K m value of E. coli native DAHP synthase for D-erythrose 4-phosphate: AroF: K m =81.4 μM, k cat =29.5 s −1 ; AroG: K m =141 μM, k cat =10.3 s −1 ; AroH: K m =35 μM, R cat =20.6 s −1 . References are: Ramilo, C. A.; Evans, J. N. S., Protein Express. Purif. 1997, 9, 253-261 (for AroF); Sheflyan, G. Y. et al., J. Am. Chem. Soc. 1998, 120, 11027-11032 (for AroG); and Akowski, J. P.; Bauerle, R., Biochemistry 1997, 36, 15817-15822 (for AroH). However, the k cat of the mutant DgoAs is significantly lower than the k cat of the native DAHP synthases.





TABLE 10



Kinetic Parameters of the Wild-Type KDPGal Aldolases and the Evolved

Variants from Cross-Species DNA Family Shuffling.









K m (E4P,



Entry
DgoA a
μM)
k cat (s −1 )
k cat /K m (μM −1 s −1 )









1
Wild-type E. coli
571
0.94
1.65 × 10 −3

2
wild-type K. pneumoniae
1507
1.39
3.22 × 10 −4

3
wild-type S. typhimurium
685
0.600
3.76 × 10 −3

4
EC03-1
124
2.49
2.01 × 10 −2

5
ST04-5
119
3.24
2.72 × 10 −2

6
NR8.165-2
157
2.51
1.60 × 10 −2

7
NR8.165-4
115
4.76
4.14 × 10 −2

8
NR8.165-6
80
0.504
6.30 × 10 −3



a All wild-type and the evolved KDPGal aldolases were expressed and purified as GST (glutathione S-transferase) fusion proteins.
































Specific Example 5
Characterization of Pyruvate-Based Shikimate Synthesis Pathway In Vivo
To examine the functioning of created shikimate pathway variant in intact microbes, growth rates and synthesis of 3-dehydroshikimate were examined. E. coli CB734/pEC03-1 and E. coli CB734/pKP03-3 were completely dependent on plasmid-encoded, evolved DgoA isozymes EC03-1 and KPO3-3, respectively, for the formation of DAHP. E. coli CB734/pNR7.126 relied on plasmid-encoded, feedback-insensitive AroF FBR for DAHP synthase activity. When cultured under identical conditions where growth was dependent on de novo synthesis of aromatic amino acids and aromatic vitamins, E. coli CB734/pEC03-1 and E. Coli CB734/pKP03-3 entered the logarithmic phases of their growths 36 h and 12 h, respectively, later than E. coli CB734/pNR7.126 This is depicted in FIG. 4 , showing growth in the absence of aromatic amino acid and aromatic vitamin supplements in glucose-containing minimal salts medium under shake-flask conditions: E. coli CB734/pNR7.126 (squares); E. coli CB734/pEC03-1 (circles); E. coli CB734/pKP03-3 (triangles).
Synthesis of 3-dehydroshikimate employed E. coli NR7, which was constructed from E. coli KL3 using site-specific chromosomal insertions to inactivate all DAHP synthase isozymes. E. coli KL3 has been extensively used in studies examining the impact of phosphoenolpyruvate availability on the synthesis of 3-dehydroshikimate. Constructs were cultured under identical fermentor-controlled conditions. E. coli NR7/pKP03-3serA synthesized 8.3 g/L of 3-dehydroshikimate in 48 h in 5% yield from glucose. Only a trace amount of this product was synthesized by NR7/pNR8.074, which expressed plasmid-encoded, native K. pneumoniae DgoA. E. coli NR7/pEC03-1serA synthesized 12 g/L of 3-dehydroshikimate in 5% yield from glucose. For comparison, 2.0 g/L of 3-dehydroshikimate was synthesized in 0.9% yield by E. coli NR7/pNR8.075, which expressed plasmid-encoded, native E coli DgoA.
Further characterization of the pyruvate-based shikimate pathways according to the present invention was performed in fed-batch fermentations (36° C., pH 7.0, 20% air saturation, with growth on glucose-containing medium). In some cases, the host cell was further transformed with a polynucleotide encoding a transketolase (E.C. 2.2.1.1), a key enzyme responsible for the in vivo synthesis of E4P, whose low concentration can present a bottleneck in the DAHP synthesis process; overexpression thereof can enhance the yield of DAHP, and thus of DHQ, DHS, and further DHS derivates, e.g., shikimate. An E. coli tktA gene provided the coding sequence used therein (SEQ ID NO:9), although various transketolase isozymes may be used to supplement in vivo production of E4P, e.g., tktB gene-encoded enzymes, such as the E. coli TktB (SEQ ID NO:12). Alternatively, a transaldolase (E.C. 2.2.1.2) may be employed for this purpose. Exemplary transaldolases include, e.g., E. coli isozymes TalA (e.g., GenBank Accession No. D13159; gi:2337773) and TalB (e.g., GenBank Accession No. D13161; gi:2337775).
E. coli CB734 was not used for fed-batch fermentation of 3-dehydroshikimic acid in this study due to its L-leucine requirement and difficulty in comparing product titer and yield with previously reported 3-dehydroshikimic acid synthesis by constructs based on E. coli KL3. Therefore, instead of constructing a CB734aroEydiB − strain, E. coli NR7 was constructed. All three DAHP synthase genes (aroF, aroG, aroH) in E. coli NR7 were inactivated by site-specific chromosomal insertions carried out in E. coli strain KL3 (AB2834 serA::aroB).
The DAHP synthase encoded by aroF and aroH in E. coli CB734 were inactivated by insertion with a chloramphenicol-resistant (Cm R ) gene and a kanamycin-resistance gene (Kan R ), respectively. P1-phage mediated transformation from E. coli CB734 could be the simplest way to disrupt the corresponding aroF and aroH genes in E. coli KL3 directly. Unfortunately, E. coli CB734 was found to be a P1 phage resistant strain possibly due to deletion of the gal operon in its chromosome. Transforming a plasmid-localized galE encoding UDP-galactose-4-epimerase in E. coli CB734 failed to reverse the P1 phage resistance phenotype of E. coli CB734.
Chromosomal inactivation of DAHP synthase genes aroF, aroG, aroH were then carried out by homologous recombination methods. Special recombinant-proficient E. coli hosts lacking exonuclease V of the RecBCD recombination complex are suitable for chromosomal recombination by transforming with linear DNA. Recombination can occur in recB or recC mutants carrying a suppressor sbcB mutation that enhances recombination by the RecF pathway or in recD mutants that are recombinase proficient but lack exonuclease V. A simple one-step method applicable to wild-type E. coli strain has been developed to use the bacteriophage A Red recombinase to mediate recombination using linear DNA with short homolog extensions.
To construct E. coli NR7, the chloramphenicol-resistant (CM R ) gene was inserted into aroF in a plasmid. The aroF::Cm R allele was isolated and transformed into strain JC7623, a hyper-recombinant recBC sbcBC strain. Chloramphenicol-resistant transformants JC7623aroF::Cm R in which the wild-type aroF was exchanged with aroF::Cm R allele by double-crossover event were obtained on chloramphenicol plates. P1-phage mediated transduction of JC7623aroF::Cm R transferred the aroF::Cm R mutation into KL3 to generate E. coli KL3aroF::Cm R . Similarly, the aroH::Kan R mutation was transferred from JC7623aroH::Kan R to KL3aroF::Cm R to prepare E coli KL3aroF::Cm R aroH::Kan R . However, attempted transfer of the aroG::tet mutation by P1 phage mediated transduction from JC7623aroG::Tc R was not successful. The aroG mutation was then generated using the λ Red recombinase method. An aroG::Tc R DNA fragment was electroporated into KL3aroF::Cm R aroH::Kan R carrying a plasmid pKD46 encoding λ Red recombinase. Recombinants were selected for tetracycline resistance (5 μg/mL) at 30° C. Plasmid pKD46 was eliminated by growth at 42° C. Disruption of chromosomal aroG was confirmed by PCR from NR7 genomic DNA using a pair of primers flanked the aroG locus to amplify a fragment corresponding to the aroG::tet allele with correct size. The E. coli KL3aroF::Cm R aroG::Tc R aroH::Kan R strain was designated as E coli NR7.
In directed evolution of E. coli KDPGal aldolase, E. coli dgoA mutants were expressed under the control of a P trc promoter in expression vector pTrc99A, while K. pneumoniae and S. typhimurium dgoA mutants were expressed under a tac promoter in pJF118EH. The trc promoter displays a spacing of 17 bp between the −35 and −10 consensus sequences a compared to a spacing of 16 bp between these regions in the tac promoter. Despite the 1 bp difference in spacing, P tac and P trc promoters are virtually of identical strength. However, plasmid pTrc99A does have a smaller size (4.2-kb vs. 5.3-kb in pJF118EH) and an increased plasmid copy number per chromosome (30 vs. 18 in pJF118EH) compared to plasmid pJF118EH. Therefore, the most active evolved E. coli mutant EC03-1 was excised from pEC03-1 and cloned into the pJF118EH vector to afford plasmid pNR8.140. Plasmid pNR8.158, pKP03-3serA and pST04-5serA were constructed by inserting a serA gene into the plasmids containing the corresponding dgoA mutants. Including the serA locus on plasmid provides the basis for plasmid maintenance during cultivation in minimal salts medium lacking L-serine supplementation. Furthermore, expression of the dgoA mutants in the same plasmid enabled an unbiased comparison of the in vivo activities of the individually evolved KDPGal aldolases in terms of the production of the pyruvate-based shikimate pathway metabolite.





TABLE 11



Synthesis of 3-dehydroshikimic acid under fermentor-controlled

conditions.










DHS a
DHS

Entry
Construct
Genes
(g/L)
(yield b )









1
NR7/pKP03-3serA
P tac KP03-3, serA
8.3
5.0%

2
NR7/pNR8.074
P tac wt-KPdgoA, serA
0
0

3
NR7/pNR8.172
P tac EC03-1, serA
5.1
2.4%

4
NR7/pNR8.170
P tac wt-ECdgoA, serA
0
0

5
NR7/pST04-5serA
P tac ST04-5, serA
6.9
3.3%

6
NR7/pNR8.121
P tac wt-STdgoA, serA
0.1
0

7
NR7/pNR8.165-2serA
P tac NR8.165-2, serA
7.4
3.3%

8
NR7/pNR8.165-4serA
P tac NR8.165-4, serA
9.3
4.6%

9
NR7/pNR8.180
P tac NR8.165-4, serA,
12.4
6.0%



tktA

10
NR7/pNR8.182
P tac aroF FBR , serA
42.7
18%

11
NR7/pNR8.190
P T5 NR8.165-4, serA,
10.5
6.5%



tktA



a DHS: 3-dehydroshikimic acid.

b yield is calculated as (mol of DHS)/(mol of glucose).











































TABLE 12



Evolved KDPGal aloldase activities towards DAHP formation.





DAHP formation assay (U a /mg)








Entry
Construct
12 h
24 h
36 h
48 h










1
NR7/pKP03-3serA
0
0.11
0.02
0.01

3
NR7/pNR8.172
0
0.05
0.05
0.05

5
NR7/ST04-5serA
0
0.30
0.25
0.22

8
NR7/pNR8.165-4serA
0
0.31
0.25
0.19

9
NR7/pNR8.180
0
0.13
0.17
0.15

11
NR7/pNR8.190
0
0.012
0.21
0.25



a One unit of DAHP synthase catalyzes the formation of one μmol of 3-dehydroshikimate per minute at 25° C. Isopropyl β-D-thioglucopyranoside (IPTG, 23.8 mg) was added at 12 h and every 6 h after.
































E. coli NR7/pKP03-3serA was cultured under glucose-rich conditions at 36° C., 20% air saturation and pH 7.0 in a 2.0-L working volume fermentor, 8.3 g/L of 3-dehydroshikimic acid was produced after 48 h in 5% mol/mol yield from glucose (entry 1, Table 11). In contrast, only trace amount of 3-dehydroshikimic acid was observed in fermentation broth of NR7/pNR8.074 which encoded wild-type K. pneumoniae dgoA and serA genes (entry 2, Table 11). E. coli NR7/pNR8.172 produced 5.1 g/L of 3-dehydroshikimic acid in 2.4% mol/mol yield under the same conditions (entry 3, Table 11), while NR7/pNR8.170, which encoded wild-type E. coli dgoA and serA genes, produced only trace amount of 3-dehydroshikimic acid (entry 4, Table 11). E. coli NR7/pST04-5serA produced 7.1 g/L 3-dehydroshikimic acid in 3.4% yield (entry 5, Table 11). For comparison, NR7/pNR8.121 which encoded the wild-type S. typhimurium dgoA gene produced a trace amount of 3-dehydroshikimic acid (entry 6, Table 11).
The evolved KDPGal aldolase specific activities toward catalyzing the condensation of pyruvate and D-erythrose 4-phosphate were measured at 12, 24, 36 and 48 h after inoculation of the culture medium in the fed-batch fermentation runs (Table 12).
With DAHP formation catalyzed by an evolved KDPGal aldolase, the first reaction in the shikimate pathway can consume the pyruvate byproduct instead of competing for the phosphoenolpyruvate substrate required by PTS-mediated glucose transport. This constitutes a fundamental departure from all previous strategies employed to increase phosphoenolpyruvate availability in microbes such as E. coli.
The examples and other embodiments described herein are exemplary and not intended to be limiting in describing the full scope of compositions and methods of this invention. Equivalent changes, modifications and variations of specific embodiments, materials, compositions and methods may be made within the scope of the present invention, with substantially similar results.