(en)Compounds, compositions and methods are provided for modulating the expression of tyrosinase. The compositions comprise oligonucleotides, targeted to nucleic acid encoding tyrosinase. Methods of using these compounds for modulation of tyrosinase expression and for diagnosis and treatment of disease associated with expression of tyrosinase are provided.
1.ApplicationNumber: US-42404103-A
1.PublishNumber: US-2004215006-A1
2.Date Publish: 20041028
3.Inventor: BENNETT C. FRANK
CONDON THOMAS
FREIER SUSAN M.
DOBIE KENNETH W.
4.Inventor Harmonized: BENNETT C FRANK(US)
CONDON THOMAS(US)
FREIER SUSAN M(US)
DOBIE KENNETH W(US)
5.Country: US
6.Claims:
(en)Compounds, compositions and methods are provided for modulating the expression of tyrosinase. The compositions comprise oligonucleotides, targeted to nucleic acid encoding tyrosinase. Methods of using these compounds for modulation of tyrosinase expression and for diagnosis and treatment of disease associated with expression of tyrosinase are provided.
7.Description:
(en)FIELD OF THE INVENTION
[0001] The present invention provides compositions and methods for modulating the expression of tyrosinase. In particular, this invention relates to compounds, particularly oligonucleotide compounds, which, in preferred embodiments, hybridize with nucleic acid molecules encoding tyrosinase. Such compounds are shown herein to modulate the expression of tyrosinase.
BACKGROUND OF THE INVENTION
[0002] The color of mammalian skin and hair is determined by a number of factors, the most important of which is the degree and distribution of melanin pigmentation. Melanin is formed in specialized pigment-producing cells known as melanocytes. Melanocytes originate in the neural crest during embryogenesis and are distributed through the embryo during its development. The migration pathways followed by the melanocytes are under strict genetic control. Melanocytes are biosynthesized in the membranous organelles named melanosomes. Mature melanosomes, located in the dendrites of melanocytes are then phagocytosed by the surrounding keratinocytes. This process is responsible for the variety of colors in human skin, hair, and eyes (Sanchez-Ferrer et al., Biochim. Biophys. Acta , 1995, 1247, 1-11).
[0003] Tyrosinase (also known as TYR and TYRL) is the key enzyme in the melanin biosynthetic pathway. Tyrosinase catalyzes the first two steps in the pathway for pigment synthesis: hydroxylation of the amino acid tyrosine into dihydroxyphenylalanine (DOPA) and then oxidation into dopaquinone. Mutations in the tyrosinase gene have been associated with oculocutaneous albinism type I (OCA1), an autosomal recessive disorder wherein the phenotype is a complete lack of melanin biosynthesis in the eyes, hair, and skin (Oetting, Pigment Cell Res ., 2000, 13, 320-325).
[0004] Tyrosinase is a type I integral membrane glycoprotein that contains 529 amino acids and can be divided into three domains: an inner domain that resides inside of melanosomes, a transmembrane domain, and a cytoplasmic domain that extends into the cytoplasm of melanocytes (Oetting, Pigment Cell Res ., 2000, 13, 320-325). The major portion of the enzyme is found inside the melanosome with only 10% (approximately 30 amino acids residues) acting as the cytoplasmic domain. Functionally, the inner domain is responsible for catalytic activity which is consistent with melanin formation occurring exclusively within melanosomes (Park and Gilchrest, Cell Mol. Biol . ( Noisy - le - grand ), 1999, 45, 919-930).
[0005] The tyrosinase locus maps to human chromosome 11q14-21 (Barton et al., Genomics , 1988, 3, 17-24). The gene contains five exons spanning more than 65 kb (Giebel et al., Genomics , 1991, 9, 435-445). The size of the introns range from 10 kb for intron 4 to over 30 kb for intron 2. Over 50% of the coding region is found in exon 1 (Oetting, Pigment Cell Res ., 2000, 13, 320-325).
[0006] Tyrosinase is an attractive target antigen for immunotherapeutic treatment of patients with melanoma because it is more homogeneously expressed than several other melanocyte differentiation antigens such as MART-1, gp100, or gp75. In two separate investigations, tyrosinase was found to be expressed in 100% of fresh melanoma specimens evaluated by immunohistochemistry or reverse transcription-polymerase chain reaction. These data indicate that tyrosinase may be an excellent target for essentially all patients with melanoma (Riley et al., J. Immunother ., 2001, 24, 212-220).
[0007] Tyrosinase has also been implicated in Vogt-Koyanagi-Harada (VKH) disease. VKH is a bilateral granulomatous panuveitis associated with central nervous system, auditory, and integumentary manifestations. It usually manifests with prodromal similar to asceptic meningitis, followed by posterior uveitis with exudative retinal detachments and disk hyperemia. T-cell clones established from patients with VKH disease and stimulated with tyrosinase family peptides demonstrated a predominantly proinflammatory, Th1-type T-cell response. Read et al. demonstrated that a VKH-like syndrome is inducible in rats by immunization with peptides derived from tyrosinase and other tyrosinase family proteins (Read et al., Curr. Opin. Ophthalmol ., 2000, 11, 437-442).
[0008] The involvement of tyrosinase in melanoma, and VKH disease make its selective inhibition an appropriate point for therapeutic intervention in these disorders.
[0009] Small molecule inhibitors are well known in the art, some examples of which include flavinoids, stilbenes, 4-substituted resorcinols, benzaldoximes and benzaldehyde-o-aldoximes (Ley and Bertram, Bioorg. Med. Chem ., 2001, 9, 1879-1885; Shimizu et al., Planta Med ., 2000, 66, 11-15).
[0010] Disclosed in U.S. Pat. No. 5,780,607 are antisense molecules demonstrated to reduce levels of the enzyme tyrosinase in melanocytes that have potential utility for treating several diseases of hyperpigmentation (Goodnow and Tam, 1998).
[0011] Disclosed and claimed in Chinese patent CN1293038 is a composition for medicines, beautifying products and cosmetics containing polynucleotide fragments of the tyrosinase coding gene or its mRNA, introduced to skin cells by liposome or other genes to prevent pigmentation in skin (He and Jiang, 2001). Also disclosed in Chinese patent CN1375277 is the addition of antisense oligodeoxynucleotide pointed to tyrosinase into skin cosmetics which can be used for beautifying and whitening skin (Fan and Huang, 2002).
[0012] Disclosed and claimed in PCT publication WO 01/58918 are antisense oligonucleotides targeting regions of the tyrosinase gene including the initiation codon, the coding region and the non-coding 3′ region for use as depigmentation or skin whitening agents in a cosmetic composition or a dermatological composition (Kurfurst and Joly, 2001).
[0013] Currently, there are no therapeutic agents inhibiting the synthesis of tyrosinase. To date, investigative strategies aimed at modulating tyrosinase function have involved the use of gene knockouts in mice, small molecule inhibitors and antisense molecules.
[0014] Antisense technology is emerging as an effective means for reducing the expression of specific gene products and may therefore prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications for the modulation of tyrosinase expression.
[0015] The present invention provides the compositions and methods for modulating tyrosinase expression.
SUMMARY OF THE INVENTION
[0016] The present invention is directed to compounds, especially nucleic acid and nucleic acid-like oligomers, which are targeted to a nucleic acid encoding tyrosinase, and which modulate the expression of tyrosinase. Pharmaceutical and other compositions comprising the compounds of the invention are also provided. Further provided are methods of screening for modulators of tyrosinase and methods of modulating the expression of tyrosinase in cells, tissues or animals comprising contacting said cells, tissues or animals with one or more of the compounds or compositions of the invention. Methods of treating an animal, particularly a human, suspected of having or being prone to a disease or condition associated with expression of tyrosinase are also set forth herein. Such methods comprise administering a therapeutically or prophylactically effective amount of one or more of the compounds or compositions of the invention to the person in need of treatment.
DETAILED DESCRIPTION OF THE INVENTION
A. Overview of the Invention
[0017] The present invention employs compounds, preferably oligonucleotides and similar species for use in modulating the function or effect of nucleic acid molecules encoding tyrosinase. This is accomplished by providing oligonucleotides which specifically hybridize with one or more nucleic acid molecules encoding tyrosinase. As used herein, the terms “target nucleic acid” and “nucleic acid molecule encoding tyrosinase” have been used for convenience to encompass DNA encoding tyrosinase, RNA (including pre-mRNA and mRNA or portions thereof) transcribed from such DNA, and also cDNA derived from such RNA. The hybridization of a compound of this invention with its target nucleic acid is generally referred to as “antisense”. Consequently, the preferred mechanism believed to be included in the practice of some preferred embodiments of the invention is referred to herein as “antisense inhibition.” Such antisense inhibition is typically based upon hydrogen bonding-based hybridization of oligonucleotide strands or segments such that at least one strand or segment is cleaved, degraded, or otherwise rendered inoperable. In this regard, it is presently preferred to target specific nucleic acid molecules and their functions for such antisense inhibition.
[0018] The functions of DNA to be interfered with can include replication and transcription. Replication and transcription, for example, can be from an endogenous cellular template, a vector, a plasmid construct or otherwise. The functions of RNA to be interfered with can include functions such as translocation of the RNA to a site of protein translation, translocation of the RNA to sites within the cell which are distant from the site of RNA synthesis, translation of protein from the RNA, splicing of the RNA to yield one or more RNA species, and catalytic activity or complex formation involving the RNA which may be engaged in or facilitated by the RNA. One preferred result of such interference with target nucleic acid function is modulation of the expression of tyrosinase. In the context of the present invention, “modulation” and “modulation of expression” mean either an increase (stimulation) or a decrease (inhibition) in the amount or levels of a nucleic acid molecule encoding the gene, e.g., DNA or RNA. Inhibition is often the preferred form of modulation of expression and mRNA is often a preferred target nucleic acid.
[0019] In the context of this invention, “hybridization” means the pairing of complementary strands of oligomeric compounds. In the present invention, the preferred mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases (nucleobases) of the strands of oligomeric compounds. For example, adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds. Hybridization can occur under varying circumstances.
[0020] An antisense compound is specifically hybridizable when binding of the compound to the target nucleic acid interferes with the normal function of the target nucleic acid to cause a loss of activity, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target nucleic acid sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or, therapeutic treatment, and under conditions in which assays are performed in the case of in vitro assays.
[0021] In the present invention the phrase “stringent hybridization conditions” or “stringent conditions” refers to conditions under which a compound of the invention will hybridize to its target sequence, but to a minimal number of other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances and in the context of this invention, “stringent conditions” under which oligomeric compounds hybridize to a target sequence are determined by the nature and composition of the oligomeric compounds and the assays in which they are being investigated.
[0022] “Complementary,” as used herein, refers to the capacity for precise pairing between two nucleobases of an oligomeric compound. For example, if a nucleobase at a certain position of an oligonucleotide (an oligomeric compound), is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, said target nucleic acid being a DNA, RNA, or oligonucleotide molecule, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be a complementary position. The oligonucleotide and the further DNA, RNA, or oligonucleotide molecule are complementary to each other when a sufficient number of complementary positions in each molecule are occupied by nucleobases which can hydrogen bond with each other. Thus, “specifically hybridizable” and “complementary” are terms which are used to indicate a sufficient degree of precise pairing or complementarity over a sufficient number of nucleobases such that stable and specific binding occurs between the oligonucleotide and a target nucleic acid.
[0023] It is understood in the art that the sequence of an antisense compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable. Moreover, an oligonucleotide may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure). It is preferred that the antisense compounds of the present invention comprise at least 70% sequence complementarity to a target region within the target nucleic acid, more preferably that they comprise 90% sequence complementarity and even more preferably comprise 95% sequence complementarity to the target region within the target nucleic acid sequence to which they are targeted. For example, an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, an antisense compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention. Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol ., 1990, 215, 403-410; Zhang and Madden, Genome Res ., 1997, 7, 649-656).
B. Compounds of the Invention
[0024] According to the present invention, compounds include antisense oligomeric compounds, antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, alternate splicers, primers, probes, and other oligomeric compounds which hybridize to at least a portion of the target nucleic acid. As such, these compounds may be introduced in the form of single-stranded, double-stranded, circular or hairpin oligomeric compounds and may contain structural elements such as internal or terminal bulges or loops. Once introduced to a system, the compounds of the invention may elicit the action of one or more enzymes or structural proteins to effect modification of the target nucleic acid. One non-limiting example of such an enzyme is RNAse H, a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. It is known in the art that single-stranded antisense compounds which are “DNA-like” elicit RNAse H. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide-mediated inhibition of gene expression. Similar roles have been postulated for other ribonucleases such as those in the RNase III and ribonuclease L family of enzymes.
[0025] While the preferred form of antisense compound is a single-stranded antisense oligonucleotide, in many species the introduction of double-stranded structures, such as double-stranded RNA (dsRNA) molecules, has been shown to induce potent and specific antisense-mediated reduction of the function of a gene or its associated gene products. This phenomenon occurs in both plants and animals and is believed to have an evolutionary connection to viral defense and transposon silencing.
[0026] The first evidence that dsRNA could lead to gene silencing in animals came in 1995 from work in the nematode, Caenorhabditis elegans (Guo and Kempheus, Cell , 1995, 81, 611-620). Montgomery et al. have shown that the primary interference effects of dsRNA are posttranscriptional (Montgomery et al., Proc. Natl. Acad. Sci. USA , 1998, 95, 15502-15507). The posttranscriptional antisense mechanism defined in Caenorhabditis elegans resulting from exposure to double-stranded RNA (dsRNA) has since been designated RNA interference (RNAi). This term has been generalized to mean antisense-mediated gene silencing involving the introduction of dsRNA leading to the sequence-specific reduction of endogenous targeted mRNA levels (Fire et al., Nature , 1998, 391, 806-811). Recently, it has been shown that it is, in fact, the single-stranded RNA oligomers of antisense polarity of the dsRNAs which are the potent inducers of RNAi (Tijsterman et al., Science , 2002, 295, 694-697).
[0027] In the context of this invention, the term “oligomeric compound” refers to a polymer or oligomer comprising a plurality of monomeric units. In the context of this invention, the term “oligonucleotide” refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics, chimeras, analogs and homologs thereof. This term includes oligonucleotides composed of naturally occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for a target nucleic acid and increased stability in the presence of nucleases.
[0028] While oligonucleotides are a preferred form of the compounds of this invention, the present invention comprehends other families of compounds as well, including but not limited to oligonucleotide analogs and mimetics such as those described herein.
[0029] The compounds in accordance with this invention preferably comprise from about 8 to about 80 nucleobases (i.e. from about 8 to about 80 linked nucleosides). One of ordinary skill in the art will appreciate that the invention embodies compounds of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 nucleobases in length.
[0030] In one preferred embodiment, the compounds of the invention are 12 to 50 nucleobases in length. One having ordinary skill in the art will appreciate that this embodies compounds of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleobases in length.
[0031] In another preferred embodiment, the compounds of the invention are 15 to 30 nucleobases in length. One having ordinary skill in the art will appreciate that this embodies compounds of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length.
[0032] Particularly preferred compounds are oligonucleotides from about 12 to about 50 nucleobases, even more preferably those comprising from about 15 to about 30 nucleobases.
[0033] Antisense compounds 8-80 nucleobases in length comprising a stretch of at least eight (8) consecutive nucleobases selected from within the illustrative antisense compounds are considered to be suitable antisense compounds as well.
[0034] Exemplary preferred antisense compounds include oligonucleotide sequences that comprise at least the 8 consecutive nucleobases from the 5′-terminus of one of the illustrative preferred antisense compounds (the remaining nucleobases being a consecutive stretch of the same oligonucleotide beginning immediately upstream of the 5′-terminus of the antisense compound which is specifically hybridizable to the target nucleic acid and continuing until the oligonucleotide contains about 8 to about 80 nucleobases). Similarly preferred antisense compounds are represented by oligonucleotide sequences that comprise at least the 8 consecutive nucleobases from the 3′-terminus of one of the illustrative preferred antisense compounds (the remaining nucleobases being a consecutive stretch of the same oligonucleotide beginning immediately downstream of the 3′-terminus of the antisense compound which is specifically hybridizable to the target nucleic acid and continuing until the oligonucleotide contains about 8 to about 80 nucleobases). One having skill in the art armed with the preferred antisense compounds illustrated herein will be able, without undue experimentation, to identify further preferred antisense compounds.
C. Targets of the Invention
[0035] “Targeting” an antisense compound to a particular nucleic acid molecule, in the context of this invention, can be a multistep process. The process usually begins with the identification of a target nucleic acid whose function is to be modulated. This target nucleic acid may be, for example, a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent. In the present invention, the target nucleic acid encodes tyrosinase.
[0036] The targeting process usually also includes determination of at least one target region, segment, or site within the target nucleic acid for the antisense interaction to occur such that the desired effect, e.g., modulation of expression, will result. Within the context of the present invention, the term “region” is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic within regions of target nucleic acids are segments. “Segments” are defined as smaller or sub-portions of regions within a target nucleic acid. “Sites,” as used in the present invention, are defined as positions within a target nucleic acid.
[0037] Since, as is known in the art, the translation initiation codon is typically 5′-AUG (in transcribed mRNA molecules; 5′-ATG in the corresponding DNA molecule), the translation initiation codon is also referred to as the “AUG codon,” the “start codon” or the “AUG start codon”. A minority of genes have a translation initiation codon having the RNA sequence 5′-GUG, 5′-UUG or 5′-CUG, and 5′-AUA, 5′-ACG and 5′-CUG have been shown to function in vivo. Thus, the terms “translation initiation codon” and “start codon” can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine (in eukaryotes) or formylmethionine (in prokaryotes). It is also known in the art that eukaryotic and prokaryotic genes may have two or more alternative start codons, any one of which may be preferentially utilized for translation initiation in a particular cell type or tissue, or under a particular set of conditions. In the context of the invention, “start codon” and “translation initiation codon” refer to the codon or codons that are used in vivo to initiate translation of an mRNA transcribed from a gene encoding tyrosinase, regardless of the sequence(s) of such codons. It is also known in the art that a translation termination codon (or “stop codon”) of a gene may have one of three sequences, i.e., 5′-UAA, 5′-UAG and 5′-UGA (the corresponding DNA sequences are 5′-TAA, 5′-TAG and 5′-TGA, respectively).
[0038] The terms “start codon region” and “translation initiation codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5′ or 3′) from a translation initiation codon. Similarly, the terms “stop codon region” and “translation termination codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5′ or 3′) from a translation termination codon. Consequently, the “start codon region” (or “translation initiation codon region”) and the “stop codon region” (or “translation termination codon region”) are all regions which may be targeted effectively with the antisense compounds of the present invention.
[0039] The open reading frame (ORF) or “coding region,” which is known in the art to refer to the region between the translation initiation codon and the translation termination codon, is also a region which may be targeted effectively. Within the context of the present invention, a preferred region is the intragenic region encompassing the translation initiation or termination codon of the open reading frame (ORF) of a gene.
[0040] Other target regions include the 5′ untranslated region (5′ UTR), known in the art to refer to the portion of an mRNA in the 5′ direction from the translation initiation codon, and thus including nucleotides between the 5′ cap site and the translation initiation codon of an mRNA (or corresponding nucleotides on the gene), and the 3′ untranslated region (3′ UTR), known in the art to refer to the portion of an mRNA in the 3′ direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3′ end of an mRNA (or corresponding nucleotides on the gene). The 5′ cap site of an mRNA comprises an N7-methylated guanosine residue joined to the 5′-most residue of the mRNA via a 5′-5′ triphosphate linkage. The 5′ cap region of an mRNA is considered to include the 5′ cap structure itself as well as the first 50 nucleotides adjacent to the cap site. It is also preferred to target the 5′ cap region.
[0041] Although some eukaryotic mRNA transcripts are directly translated, many contain one or more regions, known as “introns,” which are excised from a transcript before it is translated. The remaining (and therefore translated) regions are known as “exons” and are spliced together to form a continuous mRNA sequence. Targeting splice sites, i.e., intron-exon junctions or exon-intron junctions, may also be particularly useful in situations where aberrant splicing is implicated in disease, or where an overproduction of a particular splice product is implicated in disease. Aberrant fusion junctions due to rearrangements or deletions are also preferred target sites. mRNA transcripts produced via the process of splicing of two (or more) mRNAs from different gene sources are known as “fusion transcripts”. It is also known that introns can be effectively targeted using antisense compounds targeted to, for example, DNA or pre-mRNA.
[0042] It is also known in the art that alternative RNA transcripts can be produced from the same genomic region of DNA. These alternative transcripts are generally known as “variants”. More specifically, “pre-mRNA variants” are transcripts produced from the same genomic DNA that differ from other transcripts produced from the same genomic DNA in either their start or stop position and contain both intronic and exonic sequence.
[0043] Upon excision of one or more exon or intron regions, or portions thereof during splicing, pre-mRNA variants produce smaller “mRNA variants”. Consequently, mRNA variants are processed pre-mRNA variants and each unique pre-mRNA variant must always produce a unique mRNA variant as a result of splicing. These mRNA variants are also known as “alternative splice variants”. If no splicing of the pre-mRNA variant occurs then the pre-mRNA variant is identical to the mRNA variant.
[0044] It is also known in the art that variants can be produced through the use of alternative signals to start or stop transcription and that pre-mRNAs and mRNAs can possess more that one start codon or stop codon. Variants that originate from a pre-mRNA or mRNA that use alternative start codons are known as “alternative start variants” of that pre-mRNA or mRNA. Those transcripts that use an alternative stop codon are known as “alternative stop variants” of that pre-mRNA or mRNA. One specific type of alternative stop variant is the “polyA variant” in which the multiple transcripts produced result from the alternative selection of one of the “polyA stop signals” by the transcription machinery, thereby producing transcripts that terminate at unique polyA sites. Within the context of the invention, the types of variants described herein are also preferred target nucleic acids.
[0045] The locations on the target nucleic acid to which the preferred antisense compounds hybridize are hereinbelow referred to as “preferred target segments.” As used herein the term “preferred target segment” is defined as at least an 8-nucleobase portion of a target region to which an active antisense compound is targeted. While not wishing to be bound by theory, it is presently believed that these target segments represent portions of the target nucleic acid which are accessible for hybridization.
[0046] While the specific sequences of certain preferred target segments are set forth herein, one of skill in the art will recognize that these serve to illustrate and describe particular embodiments within the scope of the present invention. Additional preferred target segments may be identified by one having ordinary skill.
[0047] Target segments 8-80 nucleobases in length comprising a stretch of at least eight (8) consecutive nucleobases selected from within the illustrative preferred target segments are considered to be suitable for targeting as well.
[0048] Target segments can include DNA or RNA sequences that comprise at least the 8 consecutive nucleobases from the 5′-terminus of one of the illustrative preferred target segments (the remaining nucleobases being a consecutive stretch of the same DNA or RNA beginning immediately upstream of the 5′-terminus of the target segment and continuing until the DNA or RNA contains about 8 to about 80 nucleobases). Similarly preferred target segments are represented by DNA or RNA sequences that comprise at least the 8 consecutive nucleobases from the 3′-terminus of one of the illustrative preferred target segments (the remaining nucleobases being a consecutive stretch of the same DNA or RNA beginning immediately downstream of the 3′-terminus of the target segment and continuing until the DNA or RNA contains about 8 to about 80 nucleobases). One having skill in the art armed with the preferred target segments illustrated herein will be able, without undue experimentation, to identify further preferred target segments.
[0049] Once one or more target regions, segments or sites have been identified, antisense compounds are chosen which are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect.
D. Screening and Target Validation
[0050] In a further embodiment, the “preferred target segments” identified herein may be employed in a screen for additional compounds that modulate the expression of tyrosinase. “Modulators” are those compounds that decrease or increase the expression of a nucleic acid molecule encoding tyrosinase and which comprise at least an 8-nucleobase portion which is complementary to a preferred target segment. The screening method comprises the steps of contacting a preferred target segment of a nucleic acid molecule encoding tyrosinase with one or more candidate modulators, and selecting for one or more candidate modulators which decrease or increase the expression of a nucleic acid molecule encoding tyrosinase. Once it is shown that the candidate modulator or modulators are capable of modulating (e.g. either decreasing or increasing) the expression of a nucleic acid molecule encoding tyrosinase, the modulator may then be employed in further investigative studies of the function of tyrosinase, or for use as a research, diagnostic, or therapeutic agent in accordance with the present invention.
[0051] The preferred target segments of the present invention may be also be combined with their respective complementary antisense compounds of the present invention to form stabilized double-stranded (duplexed) oligonucleotides.
[0052] Such double stranded oligonucleotide moieties have been shown in the art to modulate target expression and regulate translation as well as RNA processsing via an antisense mechanism. Moreover, the double-stranded moieties may be subject to chemical modifications (Fire et al., Nature , 1998, 391, 806-811; Timmons and Fire, Nature 1998, 395, 854; Timmons et al., Gene , 2001, 263, 103-112; Tabara et al., Science , 1998, 282, 430-431; Montgomery et al., Proc. Natl. Acad. Sci. USA , 1998, 95, 15502-15507; Tuschl et al., Genes Dev ., 1999, 13, 3191-3197; Elbashir et al., Nature , 2001, 411, 494-498; Elbashir et al., Genes Dev . 2001, 15, 188-200). For example, such double-stranded moieties have been shown to inhibit the target by the classical hybridization of antisense strand of the duplex to the target, thereby triggering enzymatic degradation of the target (Tijsterman et al., Science , 2002, 295, 694-697).
[0053] The compounds of the present invention can also be applied in the areas of drug discovery and target validation. The present invention comprehends the use of the compounds and preferred target segments identified herein in drug discovery efforts to elucidate relationships that exist between tyrosinase and a disease state, phenotype, or condition. These methods include detecting or modulating tyrosinase comprising contacting a sample, tissue, cell, or organism with the compounds of the present invention, measuring the nucleic acid or protein level of tyrosinase and/or a related phenotypic or chemical endpoint at some time after treatment, and optionally comparing the measured value to a non-treated sample or sample treated with a further compound of the invention. These methods can also be performed in parallel or in combination with other experiments to determine the function of unknown genes for the process of target validation or to determine the validity of a particular gene product as a target for treatment or prevention of a particular disease, condition, or phenotype.
E. Kits, Research Reagents, Diagnostics, and Therapeutics
[0054] The compounds of the present invention can be utilized for diagnostics, therapeutics, prophylaxis and as research reagents and kits. Furthermore, antisense oligonucleotides, which are able to inhibit gene expression with exquisite specificity, are often used by those of ordinary skill to elucidate the function of particular genes or to distinguish between functions of various members of a biological pathway.
[0055] For use in kits and diagnostics, the compounds of the present invention, either alone or in combination with other compounds or therapeutics, can be used as tools in differential and/or combinatorial analyses to elucidate expression patterns of a portion or the entire complement of genes expressed within cells and tissues.
[0056] As one nonlimiting example, expression patterns within cells or tissues treated with one or more antisense compounds are compared to control cells or tissues not treated with antisense compounds and the patterns produced are analyzed for differential levels of gene expression as they pertain, for example, to disease association, signaling pathway, cellular localization, expression level, size, structure or function of the genes examined. These analyses can be performed on stimulated or unstimulated cells and in the presence or absence of other compounds which affect expression patterns.
[0057] Examples of methods of gene expression analysis known in the art include DNA arrays or microarrays (Brazma and Vilo, FEBS Lett ., 2000, 480, 17-24; Celis, et al., FEBS Lett ., 2000, 480, 2-16), SAGE (serial analysis of gene expression)(Madden, et al., Drug Discov. Today , 2000, 5, 415-425), READS (restriction enzyme amplification of digested cDNAs) (Prashar and Weissman, Methods Enzymol ., 1999, 303, 258-72), TOGA (total gene expression analysis) (Sutcliffe, et al., Proc. Natl. Acad. Sci. U. S. A ., 2000, 97, 1976-81), protein arrays and proteomics (Celis, et al., FEBS Lett ., 2000, 480, 2-16; Jungblut, et al., Electrophoresis , 1999, 20, 2100-10), expressed sequence tag (EST) sequencing (Celis, et al., FEBS Lett ., 2000, 480, 2-16; Larsson, et al., J. Biotechnol ., 2000, 80, 143-57), subtractive RNA fingerprinting (SuRF) (Fuchs, et al., Anal. Biochem ., 2000, 286, 91-98; Larson, et al., Cytometry , 2000, 41, 203-208), subtractive cloning, differential display (DD) (Jurecic and Belmont, Curr. Opin. Microbiol ., 2000, 3, 316-21), comparative genomic hybridization (Carulli, et al., J. Cell Biochem. Suppl ., 1998, 31, 286-96), FISH (fluorescent in situ hybridization) techniques (Going and Gusterson, Eur. J. Cancer , 1999, 35, 1895-904) and mass spectrometry methods (To, Comb. Chem. High Throughput Screen , 2000, 3, 235-41).
[0058] The compounds of the invention are useful for research and diagnostics, because these compounds hybridize to nucleic acids encoding tyrosinase. For example, oligonucleotides that are shown to hybridize with such efficiency and under such conditions as disclosed herein as to be effective tyrosinase inhibitors will also be effective primers or probes under conditions favoring gene amplification or detection, respectively. These primers and probes are useful in methods requiring the specific detection of nucleic acid molecules encoding tyrosinase and in the amplification of said nucleic acid molecules for detection or for use in further studies of tyrosinase. Hybridization of the antisense oligonucleotides, particularly the primers and probes, of the invention with a nucleic acid encoding tyrosinase can be detected by means known in the art. Such means may include conjugation of an enzyme to the oligonucleotide, radiolabelling of the oligonucleotide or any other suitable detection means. Kits using such detection means for detecting the level of tyrosinase in a sample may also be prepared.
[0059] The specificity and sensitivity of antisense is also harnessed by those of skill in the art for therapeutic uses. Antisense compounds have been employed as therapeutic moieties in the treatment of disease states in animals, including humans. Antisense oligonucleotide drugs, including ribozymes, have been safely and effectively administered to humans and numerous clinical trials are presently underway. It is thus established that antisense compounds can be useful therapeutic modalities that can be configured to be useful in treatment regimes for the treatment of cells, tissues and animals, especially humans.
[0060] For therapeutics, an animal, preferably a human, suspected of having a disease or disorder which can be treated by modulating the expression of tyrosinase is treated by administering antisense compounds in accordance with this invention. For example, in one non-limiting embodiment, the methods comprise the step of administering to the animal in need of treatment, a therapeutically effective amount of a tyrosinase inhibitor. The tyrosinase inhibitors of the present invention effectively inhibit the activity of the tyrosinase protein or inhibit the expression of the tyrosinase protein. In one embodiment, the activity or expression of tyrosinase in an animal is inhibited by about 10%. Preferably, the activity or expression of tyrosinase in an animal is inhibited by about 30%. More preferably, the activity or expression of tyrosinase in an animal is inhibited by 50% or more.
[0061] For example, the reduction of the expression of tyrosinase may be measured in serum, adipose tissue, liver or any other body fluid, tissue or organ of the animal. Preferably, the cells contained within said fluids, tissues or organs being analyzed contain a nucleic acid molecule encoding tyrosinase protein and/or the tyrosinase protein itself.
[0062] The compounds of the invention can be utilized in pharmaceutical compositions by adding an effective amount of a compound to a suitable pharmaceutically acceptable diluent or carrier. Use of the compounds and methods of the invention may also be useful prophylactically.
F. Modifications
[0063] As is known in the art, a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base. The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to either the 2′, 3′ or 5′ hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn, the respective ends of this linear polymeric compound can be further joined to form a circular compound, however, linear compounds are generally preferred. In addition, linear compounds may have internal nucleobase complementarity and may therefore fold in a manner as to produce a fully or partially double-stranded compound. Within oligonucleotides, the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide. The normal linkage or backbone of RNA and DNA is a 3′ to 5′ phosphodiester linkage.
[0064] Modified Internucleoside Linkages (Backbones)
[0065] Specific examples of preferred antisense compounds useful in this invention include oligonucleotides containing modified backbones or non-natural internucleoside linkages. As defined in this specification, oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.
[0066] Preferred modified oligonucleotide backbones containing a phosphorus atom therein include, for example, phosphorothioates, chiral phosphorothioates, phosphoro-dithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3′-alkylene phosphonates, 5′-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3′-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and borano-phosphates having normal 3′-5′ linkages, 2′-5′ linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3′ to 3′, 5′ to 5′ or 2′ to 2′ linkage. Preferred oligonucleotides having inverted polarity comprise a single 3′ to 3′ linkage at the 3′-most internucleotide linkage i.e. a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof). Various salts, mixed salts and free acid forms are also included.
[0067] Representative United States patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555; 5,527,899; 5,721,218; 5,672,697 and 5,625,050, certain of which are commonly owned with this application, and each of which is herein incorporated by reference.
[0068] Preferred modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; riboacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH 2 component parts.
[0069] Representative United States patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608; 5,646,269 and 5,677,439, certain of which are commonly owned with this application, and each of which is herein incorporated by reference.
[0070] Modified Sugar and Internucleoside Linkages-Mimetics
[0071] In other preferred oligonucleotide mimetics, both the sugar and the internucleoside linkage (i.e. the backbone), of the nucleotide units are replaced with novel groups. The nucleobase units are maintained for hybridization with an appropriate target nucleic acid. One such compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone., Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al., Science , 1991, 254, 1497-1500.
[0072] Preferred embodiments of the invention are oligonucleotides with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular —CH 2 —NH—O—CH 2 —, —CH 2 —N(CH 3 )—O—CH 2 — [known as a methylene (methylimino) or MMI backbone], —CH 2 —O—N(CH 3 )—CH 2 —, —CH 2 —N(CH 3 )—N(CH 3 )—CH 2 and —O —N(CH 3 )—CH 2 —CH 2 — [wherein the native phosphodiester backbone is represented as -O- P- O- CH 2 - ] of the above referenced U.S. Pat. No. 5,489,677, and the amide backbones of the above referenced U.S. Pat. No. 5,602,240. Also preferred are oligonucleotides having morpholino backbone structures of the above-referenced U.S. Pat. No. 5,034,506.
[0073] Modified Sugars
[0074] Modified oligonucleotides may also contain one or more substituted sugar moieties. Preferred oligonucleotides comprise one of the following at the 2′ position: OH; F; O—, S—, or N-alkyl; O—, S—, or N-alkenyl; O—, S—or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C, to C 10 alkyl or C 2 to C 10 alkenyl and alkynyl. Particularly preferred are O[(CH 2 ) n O] m CH 3 , O(CH 2 ) n OCH 3 , O(CH 2 ) n NH 2 , O(CH 2 ) n CH 3 , O(CH 2 ) n ONH 2 , and O(CH 2 n ON[(CH 2 n CH 3 ] 2 , where n and m are from 1 to about 10. Other preferred oligonucleotides comprise one of the following at the 2′ position: C 1 to C 10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 , OCN, Cl, Br, CN, CF 3 , OCF 3 , SOCH 3 , SO 2 CH 3 , ONO 2 , NO 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. A preferred modification includes 2′-methoxyethoxy (2′—O—CH 2 CH 2 OCH 3 , also known as 2′—O—(2-methoxyethyl) or 2′-MOE) (Martin et al., Helv. Chim. Acta , 1995, 78, 486-504) i.e., an alkoxyalkoxy group. A further preferred modification includes 2′-dimethylaminooxyethoxy, i.e., a O(CH 2 ) 2 ON(CH 3 ) 2 group, also known as 2′-DMAOE, as described in examples hereinbelow, and 2′-dimethylaminoethoxyethoxy (also known in the art as 2′—O-dimethyl-amino-ethoxy-ethyl or 2′-DMAEOE), i.e., 2′—O—CH 2 —O—CH 2 —N(CH 3 ) 2 , also described in examples hereinbelow.
[0075] Other preferred modifications include 2′-methoxy (2′—O—CH 3 ), 2′-aminopropoxy (2′—OCH 2 CH 2 CH 2 NH 2 ), 2′-allyl (2′—CH 2 —CH═CH 2 ), 2′—O-allyl (2′—O—CH 2 —CH═CH 2 ) and 2′-fluoro (2 ′-F). The 2′-modification may be in the arabino (up) position or ribo (down) position. A preferred 2′-arabino modification is 2′-F. Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3′ position of the sugar on the 3′ terminal nucleotide or in 2′-5′ linked oligonucleotides and the 5′ position of 5′ terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative United States patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747; and 5,700,920, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.
[0076] A further preferred modification of the sugar includes Locked Nucleic Acids (LNAs) in which the 2′-hydroxyl group is linked to the 3′ or 4′ carbon atom of the sugar ring, thereby forming a bicyclic sugar moiety. The linkage is preferably a methylene (—CH 2 —) n group bridging the 2′ oxygen atom and the 4′ carbon atom wherein n is 1 or 2. LNAs and preparation thereof are described in WO 98/39352 and WO 99/14226.
[0077] Natural and Modified Nucleobases
[0078] Oligonucleotides may also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (—C?C—CH 3 ) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Further modified nucleobases include tricyclic pyrimidines such as phenoxazine cytidine(1H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), phenothiazine cytidine (1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g. 9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H-pyrido[3′, 2′:4,5]pyrrolo[2,3-d]pyrimidin-2-one). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering , pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie , International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y. S., Chapter 15 , Antisense Research and Applications , pages 289-302, Crooke, S. T. and Lebleu, B. ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 ?C and are presently preferred base substitutions, even more particularly when combined with 2′-O-methoxyethyl sugar modifications.
[0079] Representative United States patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos. 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,830,653; 5,763,588; 6,005,096; and 5,681,941, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference, and U.S. Pat. No. 5,750,692, which is commonly owned with the instant application and also herein incorporated by reference.
[0080] Conjugates
[0081] Another modification of the oligonucleotides of the invention involves chemically linking to the oligonucleotide one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide. These moieties or conjugates can include conjugate groups covalently bound to functional groups such as primary or secondary hydroxyl groups. Conjugate groups of the invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Typical conjugate groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic properties, in the context of this invention, include groups that improve uptake, enhance resistance to degradation, and/or strengthen sequence-specific hybridization with the target nucleic acid. Groups that enhance the pharmacokinetic properties, in the context of this invention, include groups that improve uptake, distribution, metabolism or excretion of the compounds of the present invention. Representative conjugate groups are disclosed in International Patent Application PCT/US92/09196, filed Oct. 23, 1992, and U.S. Pat. No. 6,287,860, the entire disclosure of which are incorporated herein by reference. Conjugate moieties include but are not limited to lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl-S-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety. Oligonucleotides of the invention may also be conjugated to active drug substances, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indomethicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic. Oligonucleotide-drug conjugates and their preparation are described in U.S. patent application Ser. No. 09/334,130 (filed Jun. 15, 1999) which is incorporated herein by reference in its entirety.
[0082] Representative United States patents that teach the preparation of such oligonucleotide conjugates include, but are not limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference.
[0083] Chimeric Compounds
[0084] It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single compound or even at a single nucleoside within an oligonucleotide.
[0085] The present invention also includes antisense compounds which are chimeric compounds. “Chimeric” antisense compounds or “chimeras,” in the context of this invention, are antisense compounds, particularly oligonucleotides, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of an oligonucleotide compound. These oligonucleotides typically contain at least one region wherein the oligonucleotide is modified so as to confer upon the oligonucleotide increased resistance to nuclease degradation, increased cellular uptake, increased stability and/or increased binding affinity for the target nucleic acid. An additional region of the oligonucleotide may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNAse H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide-mediated inhibition of gene expression. The cleavage of RNA:RNA hybrids can, in like fashion, be accomplished through the actions of endoribonucleases, such as RNAseL which cleaves both cellular and viral RNA. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.
[0086] Chimeric antisense compounds of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gapmers. Representative United States patents that teach the preparation of such hybrid structures include, but are not limited to, U.S. Pat. Nos. 5,013,830; 5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.
G. Formulations
[0087] The compounds of the invention may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor-targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption. Representative United States patents that teach the preparation of such uptake, distribution and/or absorption-assisting formulations include, but are not limited to, U.S. Pat. Nos. 5,108,921; 5,354,844; 5,416,016; 5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020; 5,591,721; 4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170; 5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854; 5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948; 5,580,575; and 5,595,756, each of which is herein incorporated by reference.
[0088] The antisense compounds of the invention encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the compounds of the invention, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
[0089] The term “prodrug” indicates a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions. In particular, prodrug versions of the oligonucleotides of the invention are prepared as SATE [(S-acetyl-2-thioethyl) phosphate] derivatives according to the methods disclosed in WO 93/24510 to Gosselin et al., published Dec. 9, 1993 or in WO 94/26764 and U.S. Pat. No. 5,770,713 to Imbach et al.
[0090] The term “pharmaceutically acceptable salts” refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. For oligonucleotides, preferred examples of pharmaceutically acceptable salts and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.
[0091] The present invention also includes pharmaceutical compositions and formulations which include the antisense compounds of the invention. The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration. Oligonucleotides with at least one 2′-O-methoxyethyl modification are believed to be particularly useful for oral administration. Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful.
[0092] The pharmaceutical formulations of the present invention, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
[0093] The compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.
[0094] Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, foams and liposome-containing formulations. The pharmaceutical compositions and formulations of the present invention may comprise one or more penetration enhancers, carriers, excipients or other active or inactive ingredients.
[0095] Emulsions are typically heterogenous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 ?m in diameter. Emulsions may contain additional components in addition to the dispersed phases, and the active drug which may be present as a solution in either the aqueous phase, oily phase or itself as a separate phase. Microemulsions are included as an embodiment of the present invention. Emulsions and their uses are well known in the art and are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.
[0096] Formulations of the present invention include liposomal formulations. As used in the present invention, the term “liposome” means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers. Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior that contains the composition to be delivered. Cationic liposomes are positively charged liposomes which are believed to interact with negatively charged DNA molecules to form a stable complex. Liposomes that are pH-sensitive or negatively-charged are believed to entrap DNA rather than complex with it. Both cationic and noncationic liposomes have been used to deliver DNA to cells.
[0097] Liposomes also include “sterically stabilized” liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome comprises one or more glycolipids or is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. Liposomes and their uses are further described in U.S. Patent 6,287,860, which is incorporated herein in its entirety.
[0098] The pharmaceutical formulations and compositions of the present invention may also include surfactants. The use of surfactants in drug products, formulations and in emulsions is well known in the art. Surfactants and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.
[0099] In one embodiment, the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly oligonucleotides. In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs. Penetration enhancers may be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants. Penetration enhancers and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.
[0100] One of skill in the art will recognize that formulations are routinely designed according to their intended use, i.e. route of administration.
[0101] Preferred formulations for topical administration include those in which the oligonucleotides of the invention are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Preferred lipids and liposomes include neutral (e.g. dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g. dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g. dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA).
[0102] For topical or other administration, oligonucleotides of the invention may be encapsulated within liposomes or may BIOLOO05US -39- PATENT form complexes thereto, in particular to cationic liposomes. Alternatively, oligonucleotides may be complexed to lipids, in particular to cationic lipids. Preferred fatty acids and esters, pharmaceutically acceptable salts thereof, and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety. Topical formulations are described in detail in United States patent application 09/315,298 filed on May 20, 1999, which is incorporated herein by reference in its entirety.
[0103] Compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable. Preferred oral formulations are those in which oligonucleotides of the invention are administered in conjunction with one or more penetration enhancers surfactants and chelators. Preferred surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof. Preferred bile acids/salts and fatty acids and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety. Also preferred are combinations of penetration enhancers, for example, fatty acids/salts in combination with bile acids/salts. A particularly preferred combination is the sodium salt of lauric acid, capric acid and UDCA. Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. Oligonucleotides of the invention may be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or nanoparticles. Oligonucleotide complexing agents and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety. Oral formulations for oligonucleotides and their preparation are described in detail in United States applications 09/108,673 (filed Jul. 1, 1998), 09/315,298 (filed May 20, 1999) and 10/071,822, filed Feb. 8, 2002, each of which is incorporated herein by reference in their entirety.
[0104] Compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
[0105] Certain embodiments of the invention provide pharmaceutical compositions containing one or more oligomeric compounds and one or more other chemotherapeutic agents which function by a non-antisense mechanism. Examples of such chemotherapeutic agents include but are not limited to cancer chemotherapeutic drugs such as daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin, bleomycin, mafosfamide, ifosfamide, cytosine arabinoside, bis-chloroethylnitrosurea, busulfan, mitomycin C, actinomycin D, mithramycin, prednisone, hydroxyprogesterone, testosterone, tamoxifen, dacarbazine, procarbazine, hexamethylmelamine, pentamethylmelamine, mitoxantrone, amsacrine, chlorambucil, methylcyclohexylnitrosurea, nitrogen mustards, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-azacytidine, hydroxyurea, deoxyco-formycin, 4-hydroxyperoxycyclophosphoramide, 5-fluorouracil (5-FU), 5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX), colchicine, taxol, vincristine, vinblastine, etoposide (VP-16), trimetrexate, irinotecan, topotecan, gemcitabine, teniposide, cisplatin and diethylstilbestrol (DES). When used with the compounds of the invention, such chemotherapeutic agents may be used individually (e.g., 5-FU and oligonucleotide), sequentially (e.g., 5-FU and oligonucleotide for a period of time followed by MTX and oligonucleotide), or in combination with one or more other such chemotherapeutic agents (e.g., 5-FU, MTX and oligonucleotide, or 5-FU, radiotherapy and oligonucleotide). Anti-inflammatory drugs, including but not limited to nonsteroidal anti-inflammatory drugs and corticosteroids, and antiviral drugs, including but not limited to ribivirin, vidarabine, acyclovir and ganciclovir, may also be combined in compositions of the invention. Combinations of antisense compounds and other non-antisense drugs are also within the scope of this invention. Two or more combined compounds may be used together or sequentially.
[0106] In another related embodiment, compositions of the invention may contain one or more antisense compounds, particularly oligonucleotides, targeted to a first nucleic acid and one or more additional antisense compounds targeted to a second nucleic acid target. Alternatively, compositions of the invention may contain two or more antisense compounds targeted to different regions of the same nucleic acid target. Numerous examples of antisense compounds are known in the art. Two or more combined compounds may be used together or sequentially.
H. Dosing
[0107] The formulation of therapeutic compositions and their subsequent administration (dosing) is believed to be within the skill of those in the art. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC 50 s found to be effective in in vitro and in vivo animal models. In general, dosage is from 0.01 ug to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations of the drug in bodily fluids or tissues. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the oligonucleotide is administered in maintenance doses, ranging from 0.01 ug to 100 g per kg of body weight, once or more daily, to once every 20 years.
[0108] While the present invention has been described with specificity in accordance with certain of its preferred embodiments, the following examples serve only to illustrate the invention and are not intended to limit the same.
EXAMPLES
Example 1
Synthesis of Nucleoside Phosphoramidites
[0109] The following compounds, including amidites and their intermediates were prepared as described in U.S. Pat. No. 6,426,220 and published PCT WO 02/36743; 5′-O-Dimethoxytrityl-thymidine intermediate for 5-methyl dC amidite, 5′-O-Dimethoxytrityl-2′-deoxy-5-methylcytidine intermediate for 5-methyl-dC amidite, 5′-O-Dimethoxytrityl-2′-deoxy-N4-benzoyl-5-methylcytidine penultimate intermediate for 5-methyl dC amidite, [5′-O-(4,4′-Dimethoxytriphenylmethyl)-2′-deoxy-N 4 -benzoyl-5-methylcytidin-3′-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite (5-methyl dC amidite), 2′-Fluorodeoxyadenosine, 2′-Fluorodeoxyguanosine, 2′-Fluorouridine, 2′-Fluorodeoxycytidine, 2′-O-(2-Methoxyethyl) modified amidites, 2′-O-(2-methoxyethyl)-5-methyluridine intermediate, 5′-O-DMT-2′-O-(2-methoxyethyl)-5-methyluridine penultimate intermediate, [5′-O-(4,4′-Dimethoxytriphenylmethyl)-2′-O-(2-methoxyethyl)-5-methyluridin-3′-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite (MOE T amidite), 5′-O-Dimethoxytrityl-2′-O-(2-methoxyethyl)-5-methylcytidine intermediate, 5′-O-dimethoxytrityl-2′-O-(2-methoxyethyl)-N 4 -benzoyl-5-methyl-cytidine penultimate intermediate, [5′-O-(4,4′-Dimethoxytriphenylmethyl)-2′-O-(2-methoxyethyl)-N -benzoyl-5-methylcytidin-3′-O-yl]-2-cyanoethyl-N,AN-diisopropylphosphoramidite (MOE 5-Me-C amidite), [5′-O-(4,4′-Dimethoxytriphenylmethyl)-2′-O-(2-methoxyethyl)-N 6 -benzoyladenosin-31-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite (MOE A amdite), [5′-O-(4,4′-Dimethoxytriphenylmethyl)-2′-O-(2-methoxyethyl)-N -isobutyrylguanosin-3′-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite (MOE G amidite), 2′-O-(Aminooxyethyl) nucleoside amidites and 2′-O-(dimethylamino-oxyethyl) nucleoside amidites, 2′-(Dimethylaminooxyethoxy) nucleoside amidites, 5′-O-tert-Butyldiphenylsilyl-0 2 -2′-anhydro-5-methyluridine, 5′-O-tert-Butyldiphenylsilyl-2′-O-(2-hydroxyethyl)-5-methyluridine, 2′-O-([2-phthalimidoxy)ethyl]-5′-t-butyldiphenylsilyl-5-methyluridine, 5′-O-tert-butyldiphenylsilyl-2′-O-[(2-formadoximinooxy)ethyl]-5-methyluridine, 51-O-tert-Butyldiphenylsilyl-2′-O-[N,N dimethylaminooxyethyl]-5-methyluridine, 2′-O-(dimethylaminooxyethyl)-5-methyluridine, 5′-O-DMT-2′-O-(dimethylaminooxyethyl)-5-methyluridine, 5′-O-DMT-2′-O-(2-N,N-dimethylaminooxyethyl)-5-methyluridine-3′-[(2-cyanoethyl)-N,N-diisopropylphosphoramidite], 2′-(Aminooxyethoxy) nucleoside amidites, N2-isobutyryl-6-O-diphenylcarbamoyl-2′-O-(2-ethylacetyl)-5′-O-(4,4′-dimethoxytrityl)guanosine-31-[(2-cyanoethyl)-N,N-diisopropylphosphoramidite], 2′-dimethylaminoethoxyethoxy (2′-DMAEOE) nucleoside amidites, 2 1 -O-[2(2-N,N-dimethylaminoethoxy)ethyl]-5-methyl uridine, 5′-O-dimethoxytrityl-2′-O-[2(2-N,N-dimethylaminoethoxy)-ethyl)]-5-methyl uridine and 51-O-Dimethoxytrityl-2′-O-[2(2-N,N-dimethylaminoethoxy)-ethyl)]-5-methyl uridine-3′-O-(cyanoethyl-N,N-diisopropyl)phosphoramidite.
Example 2
Oligonucleotide and Oligonucleoside Synthesis
[0110] The antisense compounds used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives.
[0111] Oligonucleotides: Unsubstituted and substituted phosphodiester (P═O) oligonucleotides are synthesized on an automated DNA synthesizer (Applied Biosystems model 394) using standard phosphoramidite chemistry with oxidation by iodine.
[0112] Phosphorothioates (P═S) are synthesized similar to phosphodiester oligonucleotides with the following exceptions: thiation was effected by utilizing a 10% w/v solution of 3,H-1,2-benzodithiole-3-one 1,1-dioxide in acetonitrile for the oxidation of the phosphite linkages. The thiation reaction step time was increased to 180 sec and preceded by the normal capping step. After cleavage from the CPG column and deblocking in concentrated ammonium hydroxide at 55?C (12-16 hr), the oligonucleotides were recovered by precipitating with >3 volumes of ethanol from a 1 M NH 4 OAc solution. Phosphinate oligonucleotides are prepared as described in U.S. Pat. No. 5,508,270, herein incorporated by reference.
[0113] Alkyl phosphonate oligonucleotides are prepared as described in U.S. Pat. No. 4,469,863, herein incorporated by reference.
[0114] 3′-Deoxy-3′-methylene phosphonate oligonucleotides are prepared as described in U.S. Pat. Nos. 5,610,289 or 5,625,050, herein incorporated by reference.
[0115] Phosphoramidite oligonucleotides are prepared as described in U.S. Pat. No., 5,256,775 or U.S. Pat. No. 5,366,878, herein incorporated by reference.
[0116] Alkylphosphonothioate oligonucleotides are prepared as described in published PCT applications PCT/US94/00902 and PCT/US93/06976 (published as WO 94/17093 and WO 94/02499, respectively), herein incorporated by reference.
[0117] 3′-Deoxy-3′-amino phosphoramidate oligonucleotides are prepared as described in U.S. Pat. No. 5,476,925, herein incorporated by reference.
[0118] Phosphotriester oligonucleotides are prepared as described in U.S. Pat. No. 5,023,243, herein incorporated by reference.
[0119] Borano phosphate oligonucleotides are prepared as described in U.S. Pat. Nos. 5,130,302 and 5,177,198, both herein incorporated by reference.
[0120] Oligonucleosides: Methylenemethylimino linked oligonucleosides, also identified as MMI linked oligonucleosides, methylenedimethylhydrazo linked oligonucleosides, also identified as MDH linked oligonucleosides, and methylenecarbonylamino linked oligonucleosides, also identified as amide-3 linked oligonucleosides, and methyleneaminocarbonyl linked oligo-nucleosides, also identified as amide-4 linked oligonucleo-sides, as well as mixed backbone compounds having, for instance, alternating MMI and P═O or P═S linkages are prepared as described in U.S. Pat. Nos. 5,378,825, 5,386,023, 5,489,677, 5,602,240 and 5,610,289, all of which are herein incorporated by reference.
[0121] Formacetal and thioformacetal linked oligonucleosides are prepared as described in U.S. Pat. Nos. 5,264,562 and 5,264,564, herein incorporated by reference.
[0122] Ethylene oxide linked oligonucleosides are prepared as described in U.S. Pat. No. 5,223,618, herein incorporated by reference.
Example 3
RNA Synthesis
[0123] In general, RNA synthesis chemistry is based on the selective incorporation of various protecting groups at strategic intermediary reactions. Although one of ordinary skill in the art will understand the use of protecting groups in organic synthesis, a useful class of protecting groups includes silyl ethers. In particular bulky silyl ethers are used to protect the 5′-hydroxyl in combination with an acid-labile orthoester protecting group on the 2′-hydroxyl. This set of protecting groups is then used with standard solid-phase synthesis technology. It is important to lastly remove the acid labile orthoester protecting group after all other synthetic steps. Moreover, the early use of the silyl protecting groups during synthesis ensures facile removal when desired, without undesired deprotection of 2′ hydroxyl.
[0124] Following this procedure for the sequential protection of the 5′-hydroxyl in combination with protection of the 2′-hydroxyl by protecting groups that are differentially removed and are differentially chemically labile, RNA oligonucleotides were synthesized.
[0125] RNA oligonucleotides are synthesized in a stepwise fashion. Each nucleotide is added sequentially (3′- to 5′-direction) to a solid support-bound oligonucleotide. The first nucleoside at the 3′-end of the chain is covalently attached to a solid support. The nucleotide precursor, a ribonucleoside phosphoramidite, and activator are added, coupling the second base onto the 5′-end of the first nucleoside. The support is washed and any unreacted 5′-hydroxyl groups are capped with acetic anhydride to yield 5′-acetyl moieties. The linkage is then oxidized to the more stable and ultimately desired P(V) linkage. At the end of the nucleotide addition cycle, the 5′-silyl group is cleaved with fluoride. The cycle is repeated for each subsequent nucleotide.
[0126] Following synthesis, the methyl protecting groups on the phosphates are cleaved in 30 minutes utilizing 1 M disodium-2-carbamoyl-2-cyanoethylene-l,1-dithiolate trihydrate (S 2 Na 2 ) in DMF. The deprotection solution is washed from the solid support-bound oligonucleotide using water. The support is then treated with 40% methylamine in water for 10 minutes at 55° C. This releases the RNA oligonucleotides into solution, deprotects the exocyclic amines, and modifies the 2′- groups. The oligonucleotides can be analyzed by anion exchange HPLC at this stage.
[0127] The 2′-orthoester groups are the last protecting groups to be removed. The ethylene glycol monoacetate orthoester protecting group developed by Dharmacon Research, Inc. (Lafayette, CO), is one example of a useful orthoester protecting group which, has the following important properties. It is stable to the conditions of nucleoside phosphoramidite synthesis and oligonucleotide synthesis. However, after oligonucleotide synthesis the oligonucleotide is treated with methylamine which not only cleaves the oligonucleotide from the solid support but also removes the acetyl groups from the orthoesters. The resulting 2-ethyl-hydroxyl substituents on the orthoester are less electron withdrawing than the acetylated precursor. As a result, the modified orthoester becomes more labile to acid-catalyzed hydrolysis. Specifically, the rate of cleavage is approximately 10 times faster after the acetyl groups are removed. Therefore, this orthoester possesses sufficient stability in order to be compatible with oligonucleotide synthesis and yet, when subsequently modified, permits deprotection to be carried out under relatively mild aqueous conditions compatible with the final RNA oligonucleotide product.
[0128] Additionally, methods of RNA synthesis are well known in the art (Scaringe, S. A. Ph.D. Thesis, University of Colorado, 1996; Scaringe, S. A., et al., J. Am. Chem. Soc ., 1998, 120, 11820-11821; Matteucci, M. D. and Caruthers, M. H. J. Am. Chem. Soc ., 1981, 103, 3185-3191; Beaucage, S. L. and Caruthers, M. H. Tetrahedron Lett ., 1981, 22, 1859-1862; Dahl, B. J., et al., Acta Chem. Scand ,. 1990, 44, 639-641; Reddy, M. P., et al., Tetrahedrom Lett ., 1994, 25, 4311-4314; Wincott, F. et al., Nucleic Acids Res ., 1995, 23, 2677-2684; Griffin, B. E., et al., Tetrahedron , 1967, 23, 2301-2313; Griffin, B. E., et al., Tetrahedron , 1967, 23, 2315-2331).
[0129] RNA antisense compounds (RNA oligonucleotides) of the present invention can be synthesized by the methods herein or purchased from Dharmacon Research, Inc (Lafayette, Colo.). Once synthesized, complementary RNA antisense compounds can then be annealed by methods known in the art to form double stranded (duplexed) antisense compounds. For example, duplexes can be formed by combining 30 μl of each of the complementary strands of RNA oligonucleotides (50 uM RNA oligonucleotide solution) and 15 μl of 5× annealing buffer (100 mM potassium acetate, 30 mM HEPES-KOH pH 7.4, 2 mM magnesium acetate) followed by heating for 1 minute at 90° C., then 1 hour at 37° C. The resulting duplexed antisense compounds can be used in kits, assays, screens, or other methods to investigate the role of a target nucleic acid.
Example 4
Synthesis of Chimeric Oligonucleotides
[0130] Chimeric oligonucleotides, oligonucleosides or mixed oligonucleotides/oligonucleosides of the invention can be of several different types. These include a first type wherein the “gap” segment of linked nucleosides is positioned between 5′ and 3′ “wing” segments of linked nucleosides and a second “open end” type wherein the “gap” segment is located at either the 3′ or the 5′ terminus of the oligomeric compound. oligonucleotides of the first type are also known in the art as “gapmers” or gapped oligonucleotides. Oligonucleotides of the second type are also known in the art as “hemimers” or “wingmers”.
[0131] [2′-O-Me]-[2′-deoxy]-[2′-O-Me] Chimeric Phosphorothioate Oligonucleotides
[0132] Chimeric oligonucleotides having 2′-O-alkyl phosphorothioate and 2′-deoxy phosphorothioate oligo-nucleotide segments are synthesized using an Applied Biosystems automated DNA synthesizer Model 394, as above. Oligonucleotides are synthesized using the automated synthesizer and 2′-deoxy-5′-dimethoxytrityl-31-O-phosphor-amidite for the DNA portion and 5′-dimethoxytrityl-2′-O-methyl-3′-O-phosphoramidite for 5′ and 3′ wings. The standard synthesis cycle is modified by incorporating coupling steps with increased reaction times for the 5′-dimethoxytrityl-2′-O-methyl-3′-O-phosphoramidite. The fully protected oligonucleotide is cleaved from the support and deprotected in concentrated ammonia (NH 40 H) for 12-16 hr at 55° C. The deprotected oligo is then recovered by an appropriate method (precipitation, column chromatography, volume reduced in vacuo and analyzed spetrophotometrically for yield and for purity by capillary electrophoresis and by mass spectrometry.
[0133] [2′-O-(2-Methoxyethyl)]-[2′-deoxy]-[2′-O-(Methoxyethyl)] Chimeric Phosphorothioate Oligonucleotides
[0134] [2′-O-(2-methoxyethyl)]-[2′-deoxy]-[-2′-O-(methoxyethyl)] chimeric phosphorothioate oligonucleotides were prepared as per the procedure above for the 2′-O-methyl chimeric oligonucleotide, with the substitution of 2′-O-(methoxyethyl) amidites for the 2′-O-methyl amidites.
[0135] [2′-O-(2-Methoxyethyl)Phosphodiester]-[2′-deoxy Phosphorothioate]-[2′-O-(2-Methoxyethyl) Phosphodiester] Chimeric Oligonucleotides
[0136] [2′-O-(2-methoxyethyl phosphodiester]-[2′-deoxy phosphorothioate]-[2′-O-(methoxyethyl) phosphodiester] chimeric oligonucleotides are prepared as per the above procedure for the 2′-O-methyl chimeric oligonucleotide with the substitution of 2′-O-(methoxyethyl) amidites for the 2′-O-methyl amidites, oxidation with iodine to generate the phosphodiester internucleotide linkages within the wing portions of the chimeric structures and sulfurization utilizing 3,H-1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) to generate the phosphorothioate internucleotide linkages for the center gap.
[0137] Other chimeric oligonucleotides, chimeric oligonucleosides and mixed chimeric oligonucleotides/oligonucleosides are synthesized according to U.S. Pat. No. 5,623,065, herein incorporated by reference.
Example 5
Design and Screening of Duplexed Antisense Compounds Targeting Tyrosinase
[0138] In accordance with the present invention, a series of nucleic acid duplexes comprising the antisense compounds of the present invention and their complements can be designed to target tyrosinase. The nucleobase sequence of the antisense strand of the duplex comprises at least a portion of an oligonucleotide in Table 1. The ends of the strands may be modified by the addition of one or more natural or modified nucleobases to form an overhang. The sense strand of the dsRNA is then designed and synthesized as the complement of the antisense strand and may also contain modifications or additions to either terminus. For example, in one embodiment, both strands of the dsRNA duplex would be complementary over the central nucleobases, each having overhangs at one or both termini.
[0139] For example, a duplex comprising an antisense strand having the sequence CGAGAGGCGGACGGGACCG and having a two-nucleobase overhang of deoxythymidine(dT) would have the following structure:
cgagaggcggacgggaccgTT Antisense Strand ||||||||||||||||||| TTgctctccgcctgccctggc Complement
[0140] RNA strands of the duplex can be synthesized by methods disclosed herein or purchased from Dharmacon Research Inc., (Lafayette, Colo.). Once synthesized, the complementary strands are annealed. The single strands are aliquoted and diluted to a concentration of 50 um. Once diluted, 30 uL of each strand is combined with 15 uL of a 5× solution of annealing buffer. The final concentration of said buffer is 100 mM potassium acetate, 30 mM HEPES-KOH pH 7.4, and 2 mM magnesium acetate. The final volume is 75 uL. This solution is incubated for 1 minute at 90° C. and then centrifuged for 15 seconds. The tube is allowed to sit for 1 hour at 37° C. at which time the dsRNA duplexes are used in experimentation. The final concentration of the dsRNA duplex is 20 uM. This solution can be stored frozen (−20° C.) and freeze-thawed up to 5 times.
[0141] Once prepared, the duplexed antisense compounds are evaluated for their ability to modulate tyrosinase expression.
[0142] When cells reached 80% confluency, they are treated with duplexed antisense compounds of the invention. For cells grown in 96-well plates, wells are washed once with 200 μL OPTI-MEM-1 reduced-serum medium (Gibco BRL) and then treated with 130 μL of OPTI-MEM-1 containing 12 μg/mL LIPOFECTIN (Gibco BRL) and the desired duplex antisense compound at a final concentration of 200 nM. After 5 hours of treatment, the medium is replaced with fresh medium. Cells are harvested 16 hours after treatment, at which time RNA is isolated and target reduction measured by RT-PCR.
Example 6
Oligonucleotide Isolation
[0143] After cleavage from the controlled pore glass solid support and deblocking in concentrated ammonium hydroxide at 55?C for 12-16 hours, the oligonucleotides or oligonucleosides are recovered by precipitation out of 1 M NH 4 OAc with >3 volumes of ethanol. Synthesized oligonucleotides were analyzed by electrospray mass spectroscopy (molecular weight determination) and by capillary gel electrophoresis and judged to be at least 70% full length material. The relative amounts of phosphorothioate and phosphodiester linkages obtained in the synthesis was determined by the ratio of correct molecular weight relative to the −16 amu product (+/−32 +/−48). For some studies oligonucleotides were purified by HPLC, as described by Chiang et al., J. Biol. Chem . 1991, 266, 18162-18171. Results obtained with HPLC-purified material were similar to those obtained with non-HPLC purified material.
Example 7
Oligonucleotide Synthesis-96 Well Plate Format
[0144] Oligonucleotides were synthesized via solid phase P(III) phosphoramidite chemistry on an automated synthesizer capable of assembling 96 sequences simultaneously in a 96-well format. Phosphodiester internucleotide linkages were afforded by oxidation with aqueous iodine. Phosphorothioate internucleotide linkages were generated by sulfurization utilizing 3, H-1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) in anhydrous acetonitrile. Standard base-protected beta-cyanoethyl-diiso-propyl phosphoramidites were purchased from commercial vendors (e.g. PE-Applied Biosystems, Foster City, Calif., or Pharmacia, Piscataway, N.J.). Non-standard nucleosides are synthesized as per standard or patented methods. They are utilized as base protected beta-cyanoethyldiisopropyl phosphoramidites.
[0145] Oligonucleotides were cleaved from support and deprotected with concentrated NH 4 OH at elevated temperature (55-60° C.) for 12-16 hours and the released product then dried in vacuo. The dried product was then re-suspended in sterile water to afford a master plate from which all analytical and test plate samples are then diluted utilizing robotic pipettors.
Example 8
Oligonucleotide Analysis -96-Well Plate Format
[0146] The concentration of oligonucleotide in each well was assessed by dilution of samples and UV absorption spectroscopy. The full-length integrity of the individual products was evaluated by capillary electrophoresis (CE) in either the 96-well format (Beckman P/ACE? MDQ) or, for individually prepared samples, on a commercial CE apparatus (e.g., Beckman P/ACE? 5000, ABI 270). Base and backbone composition was confirmed by mass analysis of the compounds utilizing electrospray-mass spectroscopy. All assay test plates were diluted from the master plate using single and multi-channel robotic pipettors. Plates were judged to be acceptable if at least 85% of the compounds on the plate were at least 85% full length.
Example 9
Cell Culture and Oligonucleotide Treatment
[0147] The effect of antisense compounds on target nucleic acid expression can be tested in any of a variety of cell types provided that the target nucleic acid is present at measurable levels. This can be routinely determined using, for example, PCR or Northern blot analysis. The following cell types are provided for illustrative purposes, but other cell types can be routinely used, provided that the target is expressed in the cell type chosen. This can be readily determined by methods routine in the art, for example Northern blot analysis, ribonuclease protection assays, or RT-PCR.
[0148] T-24 Cells:
[0149] The human transitional cell bladder carcinoma cell line T-24 was obtained from the American Type Culture Collection (ATCC) (Manassas, Va.). T-24 cells were routinely cultured in complete McCoy's 5A basal media (Invitrogen Corporation, Carlsbad, Calif.) supplemented with 10% fetal calf serum (Invitrogen Corporation, Carlsbad, Calif.), penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Invitrogen Corporation, Carlsbad, Calif.). Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells were seeded into 96-well plates (Falcon-Primaria #353872) at a density of 7000 cells/well for use in RT-PCR analysis.
[0150] For Northern blotting or other analysis, cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide.
[0151] A549 Cells:
[0152] The human lung carcinoma cell line A549 was obtained from the American Type Culture Collection (ATCC) (Manassas, Va.). A549 cells were routinely cultured in DMEM basal media (Invitrogen Corporation, Carlsbad, Calif.) supplemented with 10% fetal calf serum (Invitrogen Corporation, Carlsbad, Calif.), penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Invitrogen Corporation, Carlsbad, Calif.). Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence.
[0153] NHDF Cells:
[0154] Human neonatal dermal fibroblast (NHDF) were obtained from the Clonetics Corporation (Walkersville, Md.). NHDFs were routinely maintained in Fibroblast Growth Medium (Clonetics Corporation, Walkersville, Md.) supplemented as recommended by the supplier. Cells were maintained for up to 10 passages as recommended by the supplier.
[0155] HEK Cells:
[0156] Human embryonic keratinocytes (HEK) were obtained from the Clonetics Corporation (Walkersville, Md.). HEKs were routinely maintained in Keratinocyte Growth Medium (Clonetics Corporation, Walkersville, Md.) formulated as recommended by the supplier. Cells were routinely maintained for up to 10 passages as recommended by the supplier.
[0157] G-361 Cells:
[0158] The human malignant melanoma cell line G-361 were obtained from the American Type Culture Collection (ATCC) (Manassas, Va.). G-361 cells were routinely maintained in RPMI1640, 10% FBS Growth Medium (Gibco, Grand Island, N.Y.) formulated as recommended by the supplier.
[0159] G-361 cells were electroporated under the following conditions. The cells are washed once in cold Opti-MEM/10% FBS, resuspended at 1×10 6 /mL and 0.4 mL, and aliquoted into a 2 mm gap cuvette. This cell suspension is treated with 5 uM antisense oligonucleotide. 175 V is applied to the cuvette for 9 msec and the cells are allowed to rest for 15 minutes. Then the cells are transferred to 1 mL of warm growth media (RPMI, 10% FBS). After incubation overnight at 5% CO 2 , 37° C., the non-adherent cells are removed by aspiration and the adherent cells are lysed in 350 ul of RLT buffer (Qiagen, Valencia, Calif.). RNA was purified on RNeasy columns (Qiagen, Valencia, Calif.) and used in the standard RT-PCR assay.
[0160] B16-F10 Cells:
[0161] The murine melanoma cell line B16-F10 were obtained from the American Type Culture Collection (ATCC) (Manassas, Va.). B16-F10 cells were routinely maintained in Dulbecco Modified Eagle's Medium with 4 mM L-glutamine, 4.5 g/L glucose, 1.5 g/L sodium bicarbonate, and 10% fetal bovine serum. Cells were routinely maintained for up to 20 passages as recommended by the supplier.
[0162] Treatment with Antisense Compounds:
[0163] When cells reached 65-75% confluency, they were treated with oligonucleotide. For cells grown in 96-well plates, wells were washed once with 100 ?L OPTI-MEM?-1 reduced-serum medium (Invitrogen Corporation, Carlsbad, Calif.) and then treated with 130 ?L of OPTI-MEM?-1 containing 3.75 ?g/mL LIPOFECTIN? (Invitrogen Corporation, Carlsbad, Calif.) and the desired concentration of oligonucleotide. Cells are treated and data are obtained in triplicate. After 4-7 hours of treatment at 37° C., the medium was replaced with fresh medium. Cells were harvested 16-24 hours after oligonucleotide treatment.
[0164] The concentration of oligonucleotide used varies from cell line to cell line. To determine the optimal oligonucleotide concentration for a particular cell line, the cells are treated with a positive control oligonucleotide at a range of concentrations. For human cells the positive control oligonucleotide is selected from either ISIS 13920 (TCCGTCATCGCTCCTCAGGG, SEQ ID NO: 1) which is targeted to human H-ras, or ISIS 18078, (GTGCGCGCGAGCCCGAAATC, SEQ ID NO: 2) which is targeted to human Jun-N-terminal kinase-2 (JNK2). Both controls are 2′-O-methoxyethyl gapmers (2′-O-methoxyethyls shown in bold) with a phosphorothioate backbone. For mouse or rat cells the positive control oligonucleotide is ISIS 15770, ATGCATTCTGCCCCCAAGGA, SEQ ID NO: 3, a 2′-O-methoxyethyl gapmer (2′-O-methoxyethyls shown in bold) with a phosphorothioate backbone which is targeted to both mouse and rat c-raf. The concentration of positive control oligonucleotide that results in 80% inhibition of c-H-ras (for ISIS 13920), JNK2 (for ISIS 18078) or c-raf (for ISIS 15770) mRNA is then utilized as the screening concentration for new oligonucleotides in subsequent experiments for that cell line. If 80% inhibition is not achieved, the lowest concentration of positive control oligonucleotide that results in 60% inhibition of c-H-ras, JNK2 or c-raf mRNA is then utilized as the oligonucleotide screening concentration in subsequent experiments for that cell line. If 60% inhibition is not achieved, that particular cell line is deemed as unsuitable for oligonucleotide transfection experiments. The concentrations of antisense oligonucleotides used herein are from 50 nM to 300 nM.
Example 10
Analysis of oligonucleotide inhibition of tyrosinase expression
[0165] Antisense modulation of tyrosinase expression can be assayed in a variety of ways known in the art. For example, tyrosinase mRNA levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or real-time PCR (RT-PCR). Real-time quantitative PCR is presently preferred. RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. The preferred method of RNA analysis of the present invention is the use of total cellular RNA as described in other examples herein. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Real-time quantitative (PCR) can be conveniently accomplished using the commercially available ABI PRISM? 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, Calif. and used according to manufacturer's instructions.
[0166] Protein levels of tyrosinase can be quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA) or fluorescence-activated cell sorting (FACS). Antibodies directed to tyrosinase can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art.
Example 11
Design of phenotypic assays and in vivo studies for the use of tyrosinase inhibitors
[0167] Phenotypic Assays
[0168] Once tyrosinase inhibitors have been identified by the methods disclosed herein, the compounds are further investigated in one or more phenotypic assays, each having measurable endpoints predictive of efficacy in the treatment of a particular disease state or condition. Phenotypic assays, kits and reagents for their use are well known to those skilled in the art and are herein used to investigate the role and/or association of tyrosinase in health and disease. Representative phenotypic assays, which can be purchased from any one of several commercial vendors, include those for determining cell viability, cytotoxicity, proliferation or cell survival (Molecular Probes, Eugene, Oreg.; PerkinElmer, Boston, Mass.), protein-based assays including enzymatic assays (Panvera, LLC, Madison, Wis.; BD Biosciences, Franklin Lakes, N.J.; Oncogene Research Products, San Diego, Calif.), cell regulation, signal transduction, inflammation, oxidative processes and apoptosis (Assay Designs Inc., Ann Arbor, Mich.), triglyceride accumulation (Sigma-Aldrich, St. Louis, Mo.), angiogenesis assays, tube formation assays, cytokine and hormone assays and metabolic assays (Chemicon International Inc., Temecula, Calif.; Amersham Biosciences, Piscataway, N.J.).
[0169] In one non-limiting example, cells determined to be appropriate for a particular phenotypic assay (i.e., MCF-7 cells selected for breast cancer studies; adipocytes for obesity studies) are treated with tyrosinase inhibitors identified from the in vitro studies as well as control compounds at optimal concentrations which are determined by the methods described above. At the end of the treatment period, treated and untreated cells are analyzed by one or more methods specific for the assay to determine phenotypic outcomes and endpoints.
[0170] Phenotypic endpoints include changes in cell morphology over time or treatment dose as well as changes in levels of cellular components such as proteins, lipids, nucleic acids, hormones, saccharides or metals. Measurements of cellular status which include pH, stage of the cell cycle, intake or excretion of biological indicators by the cell, are also endpoints of interest.
[0171] Analysis of the geneotype of the cell (measurement of the expression of one or more of the genes of the cell) after treatment is also used as an indicator of the efficacy or potency of the tyrosinase inhibitors. Hallmark genes, or those genes suspected to be associated with a specific disease state, condition, or phenotype, are measured in both treated and untreated cells.
[0172] In vivo Studies
[0173] The individual subjects of the in vivo studies described herein are warm-blooded vertebrate animals, which includes humans.
[0174] The clinical trial is subjected to rigorous controls to ensure that individuals are not unnecessarily put at risk and that they are fully informed about their role in the study. To account for the psychological effects of receiving treatments, volunteers are randomly given placebo or tyrosinase inhibitor. Furthermore, to prevent the doctors from being biased in treatments, they are not informed as to whether the medication they are administering is a tyrosinase inhibitor or a placebo. Using this randomization approach, each volunteer has the same chance of being given either the new treatment or the placebo.
[0175] Volunteers receive either the tyrosinase inhibitor or placebo for eight week period with biological parameters associated with the indicated disease state or condition being measured at the beginning (baseline measurements before any treatment), end (after the final treatment), and at regular intervals during the study period. Such measurements include the levels of nucleic acid molecules encoding tyrosinase or tyrosinase protein levels in body fluids, tissues or organs compared to pre-treatment levels. Other measurements include, but are not limited to, indices of the disease state or condition being treated, body weight, blood pressure, serum titers of pharmacologic indicators of disease or toxicity as well as ADME (absorption, distribution, metabolism and excretion) measurements.
[0176] Information recorded for each patient includes age (years), gender, height (cm), family history of disease state or condition (yes/no), motivation rating (some/moderate/great) and number and type of previous treatment regimens for the indicated disease or condition.
[0177] Volunteers taking part in this study are healthy adults (age 18 to 65 years) and roughly an equal number of males and females participate in the study. Volunteers with certain characteristics are equally distributed for placebo and tyrosinase inhibitor treatment. In general, the volunteers treated with placebo have little or no response to treatment, whereas the volunteers treated with the tyrosinase inhibitor show positive trends in their disease state or condition index at the conclusion of the study.
Example 12
RNA Isolation
[0178] Poly(A)+ MRNA Isolation
[0179] Poly(A)+ mRNA was isolated according to Miura et al., ( Clin. Chem ., 1996, 42, 1758-1764). Other methods for poly(A)+mRNA isolation are routine in the art. Briefly, for cells grown on 96-well plates, growth medium was removed from the cells and each well was washed with 200 ?L cold PBS. 60 ?L lysis buffer (10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5% NP-40, 20 mM vanadyl-ribonucleoside complex) was added to each well, the plate was gently agitated and then incubated at room temperature for five minutes. 55 ?L of lysate was transferred to Oligo d(T) coated 96-well plates (AGCT Inc., Irvine Calif.). Plates were incubated for 60 minutes at room temperature, washed 3 times with 200 ?L of wash buffer (10 mM Tris-HCl pH 7.6, 1 mM EDTA, 0.3 M NaCl). After the final wash, the plate was blotted on paper towels to remove excess wash buffer and then air-dried for 5 minutes. 60 ?L of elution buffer (5 mM Tris-HCl pH 7.6), preheated to 70?C, was added to each well, the plate was incubated on a 90?C hot plate for 5 minutes, and the eluate was then transferred to a fresh 96-well plate.
[0180] Cells grown on 100 mm or other standard plates may be treated similarly, using appropriate volumes of all solutions.
[0181] Total RNA Isolation
[0182] Total RNA was isolated using an RNEASY 96? kit and buffers purchased from Qiagen Inc. (Valencia, Calif.) following the manufacturer's recommended procedures. Briefly, for cells grown on 96-well plates, growth medium was removed from the cells and each well was washed with 200 ?L cold PBS. 150 ?L Buffer RLT was added to each well and the plate vigorously agitated for 20 seconds. 150 ?L of 70% ethanol was then added to each well and the contents mixed by pipetting three times up and down. The samples were then transferred to the RNEASY 96? well plate attached to a QIAVAC? manifold fitted with a waste collection tray and attached to a vacuum source. Vacuum was applied for 1 minute. 500 ?L of Buffer RWl was added to each well of the RNEASY 96? plate and incubated for 15 minutes and the vacuum was again applied for 1 minute. An additional 500 ?L of Buffer RW1 was added to each well of the RNEASY 96? plate and the vacuum was applied for 2 minutes. 1 mL of Buffer RPE was then added to each well of the RNEASY 96? plate and the vacuum applied for a period of 90 seconds. The Buffer RPE wash was then repeated and the vacuum was applied for an additional 3 minutes. The plate was then removed from the QIAVAC? manifold and blotted dry on paper towels. The plate was then re-attached to the QIAVAC? manifold fitted with a collection tube rack containing 1.2 mL collection tubes. RNA was then eluted by pipetting 140 ?L of RNAse free water into each well, incubating 1 minute, and then applying the vacuum for 3 minutes.
[0183] The repetitive pipetting and elution steps may be automated using a QIAGEN Bio-Robot 9604 (Qiagen, Inc., Valencia Calif.). Essentially, after lysing of the cells on the culture plate, the plate is transferred to the robot deck where the pipetting, DNase treatment and elution steps are carried out.
Example 13
Real-time Quantitative PCR Analysis of tyrosinase mRNA Levels
[0184] Quantitation of tyrosinase mRNA levels was accomplished by real-time quantitative PCR using the ABI PRISM? 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, Calif.) according to manufacturer's instructions. This is a closed-tube, non-gel-based, fluorescence detection system which allows high-throughput quantitation of polymerase chain reaction (PCR) products in real-time. As opposed to standard PCR in which amplification products are quantitated after the PCR is completed, products in real-time quantitative PCR are quantitated as they accumulate. This is accomplished by including in the PCR reaction an oligonucleotide probe that anneals specifically between the forward and reverse PCR primers, and contains two fluorescent dyes. A reporter dye (e.g., FAM or JOE, obtained from either PE-Applied Biosystems, Foster City, Calif., Operon Technologies Inc., Alameda, Calif. or Integrated DNA Technologies Inc., Coralville, Iowa) is attached to the 5′ end of the probe and a quencher dye (e.g., TAMRA, obtained from either PE-Applied Biosystems, Foster City, Calif., Operon Technologies Inc., Alameda, Calif. or Integrated DNA Technologies Inc., Coralville, Iowa) is attached to the 3′ end of the probe. When the probe and dyes are intact, reporter dye emission is quenched by the proximity of the 31 quencher dye. During amplification, annealing of the probe to the target sequence creates a substrate that can be cleaved by the 5′-exonuclease activity of Taq polymerase. During the extension phase of the PCR amplification cycle, cleavage of the probe by Taq polymerase releases the reporter dye from the remainder of the probe (and hence from the quencher moiety) and a sequence-specific fluorescent signal is generated. With each cycle, additional reporter dye molecules are cleaved from their respective probes, and the fluorescence intensity is monitored at regular intervals by laser optics built into the ABI PRISM? Sequence Detection System. In each assay, a series of parallel reactions containing serial dilutions of mRNA from untreated control samples generates a standard curve that is used to quantitate the percent inhibition after antisense oligonucleotide treatment of test samples.
[0185] Prior to quantitative PCR analysis, primer-probe sets specific to the target gene being measured are evaluated for their ability to be “multiplexed” with a GAPDH amplification reaction. In multiplexing, both the target gene and the internal standard gene GAPDH are amplified concurrently in a single sample. In this analysis, mRNA isolated from untreated cells is serially diluted. Each dilution is amplified in the presence of primer-probe sets specific for GAPDH only, target gene only (“single-plexing”), or both (multiplexing). Following PCR amplification, standard curves of GAPDH and target mRNA signal as a function of dilution are generated from both the single-plexed and multiplexed samples. If both the slope and correlation coefficient of the GAPDH and target signals generated from the multiplexed samples fall within 10% of their corresponding values generated from the single-plexed samples, the primer-probe set specific for that target is deemed multiplexable. Other methods of PCR are also known in the art.
[0186] PCR reagents were obtained from Invitrogen Corporation, (Carlsbad, Calif.). RT-PCR reactions were carried out by adding 20 ?L PCR cocktail (2.5×PCR buffer minus MgCl 2 , 6.6 mM MgCl 2 , 375 ?M each of DATP, dCTP, dCTP and dGTP, 375 nM each of forward primer and reverse primer, 125 nM of probe, 4 Units RNAse inhibitor, 1.25 Units PLATINUM® Taq, 5 Units MuLV reverse transcriptase, and 2.5×ROX dye) to 96-well plates containing 30 ?L total RNA solution (20-200 ng). The RT reaction was carried out by incubation for 30 minutes at 48?C. Following a 10 minute incubation at 95?C to activate the PLATINUM® Taq, 40 cycles of a two-step PCR protocol were carried out: 95?C for 15 seconds (denaturation) followed by 60?C for 1.5 minutes (annealing/extension).
[0187] Gene target quantities obtained by real time RT-PCR are normalized using either the expression level of GAPDH, a gene whose expression is constant, or by quantifying total RNA using RiboGreen™ (Molecular Probes, Inc. Eugene, Oreg.). GAPDH expression is quantified by real time RT-PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RiboGreen™ RNA quantification reagent (Molecular Probes, Inc. Eugene, Oreg.). Methods of RNA quantification by RiboGreen™ are taught in Jones, L. J., et al, (Analytical Biochemistry, 1998, 265, 368-374).
[0188] In this assay, 170 ?L of RiboGreen T M working reagent (RiboGreen™ reagent diluted 1:350 in 10 mM Tris-HCl, 1 mM EDTA, pH 7.5) is pipetted into a 96-well plate containing 30 ?L purified, cellular RNA. The plate is read in a CytoFluor 4000 (PE Applied Biosystems) with excitation at 485 nm and emission at 530 nm.
[0189] Probes and primers to human tyrosinase were designed to hybridize to a human tyrosinase sequence, using published sequence information (GenBank accession number M27160.1, incorporated herein as SEQ ID NO:4). For human tyrosinase the PCR primers were:
[0190] forward primer: GCCTGCTGTGGAGTTTCCA (SEQ ID NO: 5)
[0191] reverse primer: TCCATCAGGTTCTTAGAGGAGACA (SEQ ID NO: 6) and the PCR probe was: FAM-TCCGCTGGCCATTTCCCTAGAGC-TAMRA (SEQ ID NO: 7) where FAM is the fluorescent dye and TAMRA is the quencher dye. For human GAPDH the PCR primers were:
[0192] forward primer: GAAGGTGAAGGTCGGAGTC(SEQ ID NO:8)
[0193] reverse primer: GAAGATGGTGATGGGATTTC (SEQ ID NO:9) and the PCR probe was: 5′ JOE-CAAGCTTCCCGTTCTCAGCC- TAMRA 3′ (SEQ ID NO: 10) where JOE is the fluorescent reporter dye and TAMRA is the quencher dye.
[0194] Probes and primers to mouse tyrosinase were designed to hybridize to a mouse tyrosinase sequence, using published sequence information (GenBank accession number NM — 011661.1, incorporated herein as SEQ ID NO:11). For mouse tyrosinase the PCR primers were:
[0195] forward primer: TCGAGCCTGTGCCTCCTCTA (SEQ ID NO:12)
[0196] reverse primer: GACTCCCATCACCCATCCAT (SEQ ID NO: 13) and the PCR probe was: FAM-TTGTTGGCAAAAGAATGCTGCCCAC-TAMRA (SEQ ID NO: 14) where FAM is the fluorescent reporter dye and TAMRA is the quencher dye. For mouse GAPDH the PCR primers were:
[0197] forward primer: GGCAAATTCAACGGCACAGT(SEQ ID NO:15)
[0198] reverse primer: GGGTCTCGCTCCTGGAAGAT(SEQ ID NO:16) and the PCR probe was: 5′ JOE-AAGGCCGAGAATGGGAAGCTTGTCATC- TAMRA 3′ (SEQ ID NO: 17) where JOE is the fluorescent reporter dye and TAMRA is the quencher dye.
Example 14
Northern Blot Analysis of Tyrosinase mRNA Levels
[0199] Eighteen hours after antisense treatment, cell monolayers were washed twice with cold PBS and lysed in 1 mL RNAZOL? (TEL-TEST “B” Inc., Friendswood, Tex.). Total RNA was prepared following manufacturer's recommended protocols. Twenty micrograms of total RNA was fractionated by electrophoresis through 1.2% agarose gels containing 1.1% formaldehyde using a MOPS buffer system (AMRESCO, Inc. Solon, Ohio). RNA was transferred from the gel to HYBOND? −N+nylon membranes (Amersham Pharmacia Biotech, Piscataway, N.J.) by overnight capillary transfer using a Northern/Southern Transfer buffer system (TEL-TEST “B” Inc., Friendswobd, Tex.). RNA transfer was confirmed by UV visualization. Membranes were fixed by UV cross-linking using a STRATALINKER? UV Crosslinker 2400 (Stratagene, Inc, La Jolla, Calif.) and then probed using QUICKHYB? hybridization solution (Stratagene, La Jolla, Calif.) using manufacturer's recommendations for stringent conditions.
[0200] To detect human tyrosinase, a human tyrosinase specific probe was prepared by PCR using the forward primer GCCTGCTGTGGAGTTTCCA (SEQ ID NO: 5) and the reverse primer TCCATCAGGTTCTTAGAGGAGACA (SEQ ID NO: 6). To normalize for variations in loading and transfer efficiency membranes were stripped and probed for human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RNA (Clontech, Palo Alto, Calif.).
[0201] To detect mouse tyrosinase, a mouse tyrosinase specific probe was prepared by PCR using the forward primer TCGAGCCTGTGCCTCCTCTA (SEQ ID NO: 12) and the reverse primer GACTCCCATCACCCATCCAT (SEQ ID NO: 13). To normalize for variations in loading and transfer efficiency membranes were stripped and probed for mouse glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RNA (Clontech, Palo Alto, Calif.).
[0202] Hybridized membranes were visualized and quantitated using a PHOSPHORIMAGER? and IMAGEQUANT? Software V3.3 (Molecular Dynamics, Sunnyvale, Calif.). Data was normalized to GAPDH levels in untreated controls.
Example 15
Antisense Inhibition of Human Tyrosinase Expression by Chimeric Phosphorothioate Oligonucleotides having 2′-MOE Wings and a Deoxy Gap
[0203] In accordance with the present invention, a series of antisense compounds were designed to target different regions of the human tyrosinase RNA, using published sequences (GenBank accession number M27160.1, incorporated herein as SEQ ID NO: 4). The compounds are shown in Table 1. “Target site” indicates the first (5′-most) nucleotide number on the particular target sequence to which the compound binds. All compounds in Table 1 are chimeric oligonucleotides (“gapmers”) 20 nucleotides in length, composed of a central “gap” region consisting of ten 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′ directions) by five-ide nucleotide “wings”. The wings are composed of 2′-ethyl methoxyethyl (2′-MOE)nucleotides. The internucleoside (backbone) linkages are phosphorothioate (P═S) throughout the oligonucleotide. All cytidine residues are 5-ytidines. methylcytidines. The compounds were analyzed for their effect on human tyrosinase mRNA levels by quantitative real-R time PCR as described in other examples herein. Data are averages from three experiments in which G-361 cells were treated with the antisense oligonucleotides of the present invention. The positive control for each datapoint is identified in the table by sequence ID number. If present, “N.D.” indicates “no data”.
TABLE 1 Inhibition of human tyrosinase mRNA levels by chimeric phosphorothioate oligonucleotides having 2′-MOE wings and a deoxy gap TARGET TARGET SEQ ID ISIS # REGION SEQ ID NO SITE SEQUENCE % INHIB NO 149478 Coding 4 641 cctctgcctgaaagctggcc 81 19 149481 Coding 4 752 tggcaggtcctattataaaa 74 20 149485 Coding 4 1091 tcatgggcaaaatcaatgtc 82 21 149486 Coding 4 1099 ctggtgcttcatgggcaaaa 88 22 149487 Coding 4 1232 tcatctgtgcaaatgtcaca 65 23 149488 Coding 4 1276 ggctgagtaagttaggattt 83 24 149489 Coding 4 1397 tcatggtttccaggattacg 85 25 149490 Coding 4 1506 tctaaagctgaaattggcag 62 26 149491 Coding 4 1609 gggacattgttccattcata 82 27 149493 Stop 4 2091 ctctattgcctaagcctttt 24 28 Codon 149719 5′UTR 4 114 ttgcaaatgagaggtagtgt 15 29 149720 5′UTR 4 164 gacctaagcaaacccagtta 17 30 149721 5′UTR 4 212 attcttatggttagaatatt 16 31 149725 5′UTR 4 451 ctggctaattggagtcacag 81 32 149730 3′UTR 4 2099 tggccctactctattgccta 60 33 149731 3′UTR 4 2120 ttagagtgaggtcaggcttt 70 34 149735 3′UTR 4 2282 ggaaaatgttaaaagggctg 67 35 149736 3′UTR 4 2330 gttcctcattaccaaatagc 72 36 149742 5′UTR 4 20 gagaccataaagaggctaca 23 37 149743 5′UTR 4 97 tgtcaggaatagagcttctc 43 38 149744 5′UTR 4 316 ctctgaaaagcacatgactg 21 39 149745 5′UTR 4 398 cacatgtcttggctgagacc 20 40 149746 Coding 4 758 gagcactggcaggtcctatt 89 41 149747 Coding 4 1283 gatgctgggctgagtaagtt 65 42 149748 Stop 4 2078 gccttttataaatggctctg 64 43 Codon 149749 3′UTR 4 2222 gttggaagaaggctacactt 74 44 149750 3′UTR 4 2230 ctacctgagttggaagaagg 69 45 149751 3′UTR 4 2265 ctgagtgaaaacagcaagac 73 46
[0204] As shown in Table 1, SEQ ID NOs 19, 20, 21, 22, 23, 24, 25, 26, 27, 32, 33, 34, 35, 36, 41, 42, 43, 44, 45 and 46 demonstrated at least 60% inhibition of human tyrosinase expression in this assay and are therefore preferred. More preferred are SEQ ID NOs 22 and 24. The target regions to which these preferred sequences are complementary are herein referred to as “preferred target segments” and are therefore preferred for targeting by compounds of the present invention. These preferred target segments are shown in Table 3. The sequences represent the reverse complement of the preferred antisense compounds shown in Table 1. “Target site” indicates the first (5′-most) nucleotide number on the particular target nucleic acid to which the oligonucleotide binds. Also shown in Table 3 is the species in which each of the preferred target segments was found.
Example 16
Antisense Inhibition of Mouse Tyrosinase Expression by Chimeric Phosphorothioate Oligonucleotides having 2′-MOE Wings and a Deoxy Gap.
[0205] In accordance with the present invention, a second series of antisense compounds were designed to target different regions of the mouse tyrosinase RNA, using published sequences (GenBank accession number NM — 011661.1, incorporated herein as SEQ ID NO: 11, GenBank accession number X51743.1, incorporated herein as SEQ ID NO: 47, and GenBank accession number D00131.1, incorporated herein as SEQ ID NO: 48). The compounds are shown in Table 2. “Target site” indicates the first (5′-most) nucleotide number on the particular target nucleic acid to which the compound binds. All compounds in Table 2 are chimeric oligonucleotides (“gapmers”) 20 nucleotides in length, composed of a central “gap” region consisting of ten 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′ directions) by five-nucleotide “wings”. The wings are composed of 2′-methoxyethyl (2′-MOE)nucleotides. The internucleoside (backbone) linkages are phosphorothioate (P═S) throughout the oligonucleotide. All cytidine residues are 5-methylcytidines. The compounds were analyzed for their effect on mouse tyrosinase mRNA levels by quantitative real-time PCR as described in other examples herein. Data are averages from three experiments in which B16-F10 cells were treated with the antisense oligonucleotides of the present invention. The positive control for each datapoint is identified in the table by sequence ID number. If present, “N.D.” indicates “no data”.
TABLE 2 Inhibition of mouse tyrosinase mRNA levels by chimeric phosphorothioate oligonucleotides having 2′-MOE wings and a deoxy gap TARGET CONTROL SEQ ID TARGET % SEQ ID SEQ ID ISIS # REGION NO SITE SEQUENCE INHIB NO NO 191483 Start 11 48 gaacatttctcctttagatc 47 49 1 Codon 191484 Start 11 54 agccaagaacatttctcctt 63 50 1 Codon 191485 Coding 11 97 ggccatcagagatctggaaa 75 51 1 191486 Coding 11 109 ctcgaggaaaatggccatca 74 52 1 191487 Coding 11 139 ttgccaacaagttcttagag 80 53 1 191488 Coding 11 205 aggaacctctgcctgaaagc 69 54 1 191489 Coding 11 290 acagagggccaggactcacg 78 55 1 191490 Coding 11 316 agcactggcaggtcctatta 79 56 1 191491 Coding 11 346 ttccgcagttgaaacccatg 84 57 1 191492 Coding 11 371 gggcccccaaatccaaactt 78 58 1 191493 Coding 11 378 acaatttgggcccccaaatc 68 59 1 191494 Coding 11 474 agtatgttttgctaaagtga 78 60 1 191495 Coding 11 482 gagctgatagtatgttttgc 86 61 1 191496 Coding 11 496 ggatgacatagactgagctg 83 62 1 191497 Coding 11 518 atttggccataggtgcctgt 65 63 1 191498 Coding 11 536 ggtgttgacccattgttcat 45 64 1 191500 Coding 11 603 tgtgtcccttgacacatagt 43 65 1 191501 Coding 11 655 gtgcttcatgggcaaaatca 75 66 1 191502 Coding 11 686 aagaaaagtctgtgccaagg 4 67 1 191503 Coding 11 731 ttctcatccccagttagttc 49 68 1 191504 Coding 11 840 tgctgggctgagtaagttag 82 69 1 191505 Coding 11 878 gatctgctacaaatgatctg 75 70 1 191506 Coding 11 897 atggctattatactcttctg 83 71 1 191507 Coding 11 1033 atccagattcatactgggtc 78 72 1 191508 Coding 11 1133 ttgtgcatgctactttgaga 70 73 1 191510 Coding 11 1139 aaggcattgtgcatgctact 82 74 1 191512 Coding 11 1156 cattcataaagatatgtaag 33 75 1 191513 Coding 11 1224 gtccacaaaagcatggtgaa 57 76 1 191514 Coding 11 1296 gataggtgcattggcttctg 53 77 1 191515 Coding 11 1330 tgaaaggaaccatgtaagag 28 78 1 191516 Coding 11 1375 gatccttggatgttatgaag 38 79 1 191517 Coding 11 1394 tagctgtagtcatatcccag 59 80 1 191518 Coding 11 1432 tataatttctgtaaaagcct 50 81 1 191519 Coding 11 1484 gccccaagaagccatggcca 62 82 1 191520 Coding 11 1525 gcccagagagagctgcagca 69 83 1 191521 Coding 11 1621 agctgtggtagtcgtctttg 66 84 1 191522 Stop 11 1652 taggatgttcacagatggct 75 85 1 Codon 191523 3′UTR 11 1667 tcccactctgtttcctagga 90 86 1 191524 3′UTR 11 1822 atatattttagcaaatccca 57 87 1 191525 3′UTR 11 1866 aggaaattttatttagctat 69 88 1 191526 3′UTR 11 1890 aaaaccagctcaattagttg 24 89 1 191527 3′UTR 11 1923 gcctcaagtttaaataatta 27 90 1 191528 3′UTR 11 1928 aatgtgcctcaagtttaaat 39 91 1 191529 3′UTR 11 1962 tcttggaaattcacaatgaa 56 92 1 191530 3′UTR 11 2043 caagattttcaaaattgttt 4 93 1 191531 3′UTR 11 2099 ctttcctaatcattaatgaa 58 94 1 191532 3′UTR 11 2207 cctgatatttttccaccagt 52 95 1 191533 3′UTR 11 2367 tttcagattgcagtcaagcc 55 96 1 191534 3′UTR 11 2402 gctgttcccattcctttggc 57 97 1 191535 3′UTR 11 2446 cctgacactatcacactaga 42 98 1 191536 3′UTR 11 2483 caacaggtgtgaaggtctca 83 99 1 191537 3′UTR 11 2489 gtgactcaacaggtgtgaag 56 100 1 191538 3′UTR 11 2520 cagtaaaaatttacattcac 49 101 1 191539 3′UTR 11 2793 gcttcctaaaattttactaa 60 102 1 191540 3′UTR 11 2806 aaactaaaaatttgcttcct 20 103 1 191541 3′UTR 11 2869 cttgcattgcatatacaagg 66 104 1 191542 3′UTR 11 2877 agaaaatgcttgcattgcat 76 105 1 191543 3′UTR 11 2905 atatatacatgctaggtagc 70 106 1 191544 3′UTR 11 2950 ataaagacccttgtcagctg 79 107 1 191545 3′UTR 11 3049 atacataccttgaaccgcta 73 108 1 191546 3′UTR 11 3056 tatacaaatacataccttga 32 109 1 191547 3′UTR 11 3114 ttaccataatgagatatata 15 110 1 191548 3′UTR 11 3147 cagatatattgaaatagtca 72 111 1 191549 3′UTR 11 3167 tgagaatttaatgaaacttt 40 112 1 191550 3′UTR 11 3267 tttcttaacagaatgatgta 62 113 1 191551 5′UTR 47 23 catttatagaactcattttg 0 114 1 191552 5′UTR 47 100 cttatgaataaaggtcatga 0 115 1 191553 5′UTR 47 259 tttatcttctgcaaagcaca 0 116 1 191554 Coding 48 1096 gttcaaacaaaaatacttcc 0 117 1
[0206] As shown in Table 2, SEQ ID NOs 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 66, 69, 70, 71, 72, 73, 74, 76, 77, 80, 81, 82, 83, 84, 85, 86, 87, 88, 92, 94, 95, 96, 97, 99, 100, 102, 104, 105, 106, 107, 108, 111 and 113 demonsrated at least 50% inhibition of mouse tyrosinase expression in this experiment and are therefore preferred. The target regions to which these preferred sequences are complementary are herein referred to as “preferred target segments” and are therefore preferred for targeting by compounds of the present invention. These preferred target segments are shown in Table 3. The sequences represent the reverse complement of the preferred antisense compounds shown in Tables 1 and 2. These sequences are shown to contain thymine (T) but one of skill in the art will appreciate that thymine (T) is generally replaced by uracil (U) in RNA sequences. “Target site” indicates the first (5′-most) nucleotide number on the particular target nucleic acid to which the oligonucleotide binds. Also shown in Table 3 is the species in which each of the preferred target segments was found.
TABLE 3 Sequence and position of preferred target segments identified in tyrosinase. TARGET SITE SEQ ID TARGET REV COMP SEQ ID ID NO SITE SEQUENCE OF SEQ ID ACTIVE IN NO 64890 4 641 ggccagctttcaggcagagg 19 H. sapiens 118 64893 4 752 ttttataataggacctgcca 20 H. sapiens 119 64897 4 1091 gacattgattttgcccatga 21 H. sapiens 120 64898 4 1099 ttttgcccatgaagcaccag 22 H. sapiens 121 64899 4 1232 tgtgacatttgcacagatga 23 H. sapiens 122 64900 4 1276 aaatcctaacttactcagcc 24 H. sapiens 123 64901 4 1397 cgtaatcctggaaaccatga 25 H. sapiens 124 64902 4 1506 ctgccaatttcagctttaga 26 H. sapiens 125 64903 4 1609 tatgaatggaacaatgtccc 27 H. sapiens 126 65126 4 451 ctgtgactccaattagccag 32 H. sapiens 127 65131 4 2099 taggcaatagagtagggcca 33 H. sapiens 128 65132 4 2120 aaagcctgacctcactctaa 34 H. sapiens 129 65136 4 2282 cagcccttttaacattttcc 35 H. sapiens 130 65137 4 2330 gctatttggtaatgaggaac 36 H. sapiens 131 65147 4 758 aataggacctgccagtgctc 41 H. sapiens 132 65148 4 1283 aacttactcagcccagcatc 42 H. sapiens 133 65149 4 2078 cagagccatttataaaaggc 43 H. sapiens 134 65150 4 2222 aagtgtagccttcttccaac 44 H. sapiens 135 65151 4 2230 ccttcttccaactcaggtag 45 H. sapiens 136 65152 4 2265 gtcttgctgttttcactcag 46 H. sapiens 137 107916 11 54 aaggagaaatgttcttggct 50 M. musculus 138 107917 11 97 tttccagatctctgatggcc 51 M. musculus 139 107918 11 109 tgatggccattttcctcgag 52 M. musculus 140 107919 11 139 ctctaagaacttgttggcaa 53 M. musculus 141 107920 11 205 gctttcaggcagaggttcct 54 M. musculus 142 107921 11 290 cgtgagtcctggccctctgt 55 M. musculus 143 107922 11 316 taataggacctgccagtgct 56 M. musculus 144 107923 11 346 catgggtttcaactgcggaa 57 M. musculus 145 107924 11 371 aagtttggatttgggggccc 58 M. musculus 146 107925 11 378 gatttgggggcccaaattgt 59 M. musculus 147 107926 11 474 tcactttagcaaaacatact 60 M. musculus 148 107927 11 482 gcaaaacatactatcagctc 61 M. musculus 149 107928 11 496 cagctcagtctatgtcatcc 62 M. musculus 150 107929 11 518 acaggcacctatggccaaat 63 M. musculus 151 107933 11 655 tgattttgcccatgaagcac 66 M. musculus 152 107936 11 840 ctaacttactcagcccagca 69 M. musculus 153 107937 11 878 cagatcatttgtagcagatc 70 M. musculus 154 107938 11 897 cagaagagtataatagccat 71 M. musculus 155 107939 11 1033 gacccagtatgaatctggat 72 M. musculus 156 107940 11 1133 tctcaaagtagcatgcacaa 73 M. musculus 157 107941 11 1139 agtagcatgcacaatgcctt 74 M. musculus 158 107943 11 1224 ttcaccatgcttttgtggac 76 M. musculus 159 107944 11 1296 cagaagccaatgcacctatc 77 M. musculus 160 107947 11 1394 ctgggatatgactacagcta 80 M. musculus 161 107948 11 1432 aggcttttacagaaattata 81 M. musculus 162 107949 11 1484 tggccatggcttcttggggc 82 M. musculus 163 107950 11 1525 tgctgcagctctctctgggc 83 M. musculus 164 107951 11 1621 caaagacgactaccacagct 84 M. musculus 165 107952 11 1652 agccatctgtgaacatccta 85 M. musculus 166 107953 11 1667 tcctaggaaacagagtggga 86 M. musculus 167 107954 11 1822 tgggatttgctaaaatatat 87 M. musculus 168 107955 11 1866 atagctaaataaaatttcct 88 M. musculus 169 107959 11 1962 ttcattgtgaatttccaaga 92 M. musculus 170 107961 11 2099 ttcattaatgattaggaaag 94 M. musculus 171 107962 11 2207 actggtggaaaaatatcagg 95 M. musculus 172 107963 11 2367 ggcttgactgcaatctgaaa 96 M. musculus 173 107964 11 2402 gccaaaggaatgggaacagc 97 M. musculus 174 107966 11 2483 tgagaccttcacacctgttg 99 M. musculus 175 107967 11 2489 cttcacacctgttgagtcac 100 M. musculus 176 107969 11 2793 ttagtaaaattttaggaagc 102 M. musculus 177 107971 11 2869 ccttgtatatgcaatgcaag 104 M. musculus 178 107972 11 2877 atgcaatgcaagcattttct 105 M. musculus 179 107973 11 2905 gctacctagcatgtatatat 106 M. musculus 180 107974 11 2950 cagctgacaagggtctttat 107 M. musculus 181 107975 11 3049 tagcggttcaaggtatgtat 108 M. musculus 182 107978 11 3147 tgactatttcaatatatctg 111 M. musculus 183 107980 11 3267 tacatcattctgttaagaaa 113 M. musculus 184
[0207] As these “preferred target segments” have been found by expermentation to be open to, and accessible for, hybridization with the antisense compounds of the present invention, one of skill in the art will recognize or be able to ascertain, using no more than routine experimentation, further embodiments of the invention that encompass other compounds that specifically hybridize to these preferred target segments and consequently inhibit the expression of tyrosinase.
[0208] Acccording to the present invention, antisense compounds include antisense oligomeric compounds, antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, alternate splicers, primers, probes, and other short oligomeric compounds which hybridize to at least a portion of the target nucleic acid.
Example 17
Western blot analysis of tyrosinase protein levels
[0209] Western blot analysis (immunoblot analysis) is carried out using standard methods. Cells are harvested 16-20 h after oligonucleotide treatment, washed once with PBS, suspended in Laemmli buffer (100 ul/well), boiled for 5 minutes and loaded on a 16% SDS-PAGE gel. Gels are run for 1.5 hours at 150 V, and transferred to membrane for western blotting. Appropriate primary antibody directed to tyrosinase is used, with a radiolabeled or fluorescently labeled secondary antibody directed against the primary antibody species. Bands are visualized using a PHOSPHORIMAGER? (Molecular Dynamics, Sunnyvale Calif.).
0
SEQUENCE LISTING
<160> NUMBER OF SEQ ID NOS: 184
<210> SEQ ID NO 1
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 1
tccgtcatcg ctcctcaggg 20
<210> SEQ ID NO 2
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 2
gtgcgcgcga gcccgaaatc 20
<210> SEQ ID NO 3
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 3
atgcattctg cccccaagga 20
<210> SEQ ID NO 4
<211> LENGTH: 2384
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<221> NAME/KEY: CDS
<222> LOCATION: (503)...(2092)
<400> SEQUENCE: 4
tattgagttc ttcaaacatt gtagcctctt tatggtctct gagaaataac taccttaaac 60
ccataatctt taatacttcc taaactttct taataagaga agctctattc ctgacactac 120
ctctcatttg caaggtcaaa tcatcattag ttttgtagtc tattaactgg gtttgcttag 180
gtcaggcatt attattacta accttattgt taatattcta accataagaa ttaaactatt 240
aatggtgaat agagtttttc actttaacat aggcctatcc cactggtggg atacgagcca 300
attcgaaaga aaagtcagtc atgtgctttt cagaggatga aagcttaaga taaagactaa 360
aagtgtttga tgctggaggt gggagtggta ttatataggt ctcagccaag acatgtgata 420
atcactgtag tagtagctgg aaagagaaat ctgtgactcc aattagccag ttcctgcaga 480
ccttgtgagg actagaggaa ga atg ctc ctg gct gtt ttg tac tgc ctg ctg 532
Met Leu Leu Ala Val Leu Tyr Cys Leu Leu
1 5 10
tgg agt ttc cag acc tcc gct ggc cat ttc cct aga gcc tgt gtc tcc 580
Trp Ser Phe Gln Thr Ser Ala Gly His Phe Pro Arg Ala Cys Val Ser
15 20 25
tct aag aac ctg atg gag aag gaa tgc tgt cca ccg tgg agc ggg gac 628
Ser Lys Asn Leu Met Glu Lys Glu Cys Cys Pro Pro Trp Ser Gly Asp
30 35 40
agg agt ccc tgt ggc cag ctt tca ggc aga ggt tcc tgt cag aat atc 676
Arg Ser Pro Cys Gly Gln Leu Ser Gly Arg Gly Ser Cys Gln Asn Ile
45 50 55
ctt ctg tcc aat gca cca ctt ggg cct caa ttt ccc ttc aca ggg gtg 724
Leu Leu Ser Asn Ala Pro Leu Gly Pro Gln Phe Pro Phe Thr Gly Val
60 65 70
gat gac cgg gag tcg tgg cct tcc gtc ttt tat aat agg acc tgc cag 772
Asp Asp Arg Glu Ser Trp Pro Ser Val Phe Tyr Asn Arg Thr Cys Gln
75 80 85 90
tgc tct ggc aac ttc atg gga ttc aac tgt gga aac tgc aag ttt ggc 820
Cys Ser Gly Asn Phe Met Gly Phe Asn Cys Gly Asn Cys Lys Phe Gly
95 100 105
ttt tgg gga cca aac tgc aca gag aga cga ctc ttg gtg aga aga aac 868
Phe Trp Gly Pro Asn Cys Thr Glu Arg Arg Leu Leu Val Arg Arg Asn
110 115 120
atc ttc gat ttg agt gcc cca gag aag gac aaa ttt ttt gcc tac ctc 916
Ile Phe Asp Leu Ser Ala Pro Glu Lys Asp Lys Phe Phe Ala Tyr Leu
125 130 135
act tta gca aag cat acc atc agc tca gac tat gtc atc ccc ata ggg 964
Thr Leu Ala Lys His Thr Ile Ser Ser Asp Tyr Val Ile Pro Ile Gly
140 145 150
acc tat ggc caa atg aaa aat gga tca aca ccc atg ttt aac gac atc 1012
Thr Tyr Gly Gln Met Lys Asn Gly Ser Thr Pro Met Phe Asn Asp Ile
155 160 165 170
aat att tat gac ctc ttt gtc tgg atg cat tat tat gtg tca atg gat 1060
Asn Ile Tyr Asp Leu Phe Val Trp Met His Tyr Tyr Val Ser Met Asp
175 180 185
gca ctg ctt ggg gga tct gaa atc tgg aga gac att gat ttt gcc cat 1108
Ala Leu Leu Gly Gly Ser Glu Ile Trp Arg Asp Ile Asp Phe Ala His
190 195 200
gaa gca cca gct ttt ctg cct tgg cat aga ctc ttc ttg ttg cgg tgg 1156
Glu Ala Pro Ala Phe Leu Pro Trp His Arg Leu Phe Leu Leu Arg Trp
205 210 215
gaa caa gaa atc cag aag ctg aca gga gat gaa aac ttc act att cca 1204
Glu Gln Glu Ile Gln Lys Leu Thr Gly Asp Glu Asn Phe Thr Ile Pro
220 225 230
tat tgg gac tgg cgg gat gca gaa aag tgt gac att tgc aca gat gag 1252
Tyr Trp Asp Trp Arg Asp Ala Glu Lys Cys Asp Ile Cys Thr Asp Glu
235 240 245 250
tac atg gga ggt cag cac ccc aca aat cct aac tta ctc agc cca gca 1300
Tyr Met Gly Gly Gln His Pro Thr Asn Pro Asn Leu Leu Ser Pro Ala
255 260 265
tca ttc ttc tcc tct tgg cag att gtc tgt agc cga ttg gag gag tac 1348
Ser Phe Phe Ser Ser Trp Gln Ile Val Cys Ser Arg Leu Glu Glu Tyr
270 275 280
aac agc cat cag tct tta tgc aat gga acg ccc gag gga cct tta cgg 1396
Asn Ser His Gln Ser Leu Cys Asn Gly Thr Pro Glu Gly Pro Leu Arg
285 290 295
cgt aat cct gga aac cat gac aaa tcc aga acc cca agg ctc ccc tct 1444
Arg Asn Pro Gly Asn His Asp Lys Ser Arg Thr Pro Arg Leu Pro Ser
300 305 310
tca gct gat gta gaa ttt tgc ctg agt ttg acc caa tat gaa tct ggt 1492
Ser Ala Asp Val Glu Phe Cys Leu Ser Leu Thr Gln Tyr Glu Ser Gly
315 320 325 330
tcc atg gat aaa gct gcc aat ttc agc ttt aga aat aca ctg gaa gga 1540
Ser Met Asp Lys Ala Ala Asn Phe Ser Phe Arg Asn Thr Leu Glu Gly
335 340 345
ttt gct agt cca ctt act ggg ata gcg gat gcc tct caa agc agc atg 1588
Phe Ala Ser Pro Leu Thr Gly Ile Ala Asp Ala Ser Gln Ser Ser Met
350 355 360
cac aat gcc ttg cac atc tat atg aat gga aca atg tcc cag gta cag 1636
His Asn Ala Leu His Ile Tyr Met Asn Gly Thr Met Ser Gln Val Gln
365 370 375
gga tct gcc aac gat cct atc ttc ctt ctt cac cat gca ttt gtt gac 1684
Gly Ser Ala Asn Asp Pro Ile Phe Leu Leu His His Ala Phe Val Asp
380 385 390
agt att ttt gag cag tgg ctc cga agg cac cgt cct ctt caa gaa gtt 1732
Ser Ile Phe Glu Gln Trp Leu Arg Arg His Arg Pro Leu Gln Glu Val
395 400 405 410
tat cca gaa gcc aat gca ccc att gga cat aac cgg gaa tcc tac atg 1780
Tyr Pro Glu Ala Asn Ala Pro Ile Gly His Asn Arg Glu Ser Tyr Met
415 420 425
gtt cct ttt ata cca ctg tac aga aat ggt gat ttc ttt att tca tcc 1828
Val Pro Phe Ile Pro Leu Tyr Arg Asn Gly Asp Phe Phe Ile Ser Ser
430 435 440
aaa gat ctg ggc tat gac tat agc tat cta caa gat tca gac cca gac 1876
Lys Asp Leu Gly Tyr Asp Tyr Ser Tyr Leu Gln Asp Ser Asp Pro Asp
445 450 455
tct ttt caa gac tac att aag tcc tat ttg gaa caa gcg agt cgg atc 1924
Ser Phe Gln Asp Tyr Ile Lys Ser Tyr Leu Glu Gln Ala Ser Arg Ile
460 465 470
tgg tca tgg ctc ctt ggg gcg gcg atg gta ggg gcc gtc ctc act gcc 1972
Trp Ser Trp Leu Leu Gly Ala Ala Met Val Gly Ala Val Leu Thr Ala
475 480 485 490
ctg ctg gca ggg ctt gtg agc ttg ctg tgt cgt cac aag aga aag cag 2020
Leu Leu Ala Gly Leu Val Ser Leu Leu Cys Arg His Lys Arg Lys Gln
495 500 505
ctt cct gaa gaa aag cag cca ctc ctc atg gag aaa gag gat tac cac 2068
Leu Pro Glu Glu Lys Gln Pro Leu Leu Met Glu Lys Glu Asp Tyr His
510 515 520
agc ttg tat cag agc cat tta taa aaggcttagg caatagagta gggccaaaaa 2122
Ser Leu Tyr Gln Ser His Leu *
525
gcctgacctc actctaactc aaagtaatgt ccaggttccc agagaatatc tgctggtatt 2182
tttctgtaaa gaccatttgc aaaattgtaa cctaatacaa agtgtagcct tcttccaact 2242
caggtagaac acacctgtct ttgtcttgct gttttcactc agccctttta acattttccc 2302
ctaagcccat atgtctaagg aaaggatgct atttggtaat gaggaactgt tatttgtatg 2362
tgaattaaag tgctcttatt tt 2384
<210> SEQ ID NO 5
<211> LENGTH: 19
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: PCR Primer
<400> SEQUENCE: 5
gcctgctgtg gagtttcca 19
<210> SEQ ID NO 6
<211> LENGTH: 24
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: PCR Primer
<400> SEQUENCE: 6
tccatcaggt tcttagagga gaca 24
<210> SEQ ID NO 7
<211> LENGTH: 23
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: PCR Probe
<400> SEQUENCE: 7
tccgctggcc atttccctag agc 23
<210> SEQ ID NO 8
<211> LENGTH: 19
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: PCR Primer
<400> SEQUENCE: 8
gaaggtgaag gtcggagtc 19
<210> SEQ ID NO 9
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: PCR Primer
<400> SEQUENCE: 9
gaagatggtg atgggatttc 20
<210> SEQ ID NO 10
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: PCR Probe
<400> SEQUENCE: 10
caagcttccc gttctcagcc 20
<210> SEQ ID NO 11
<211> LENGTH: 3308
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<221> NAME/KEY: CDS
<222> LOCATION: (62)...(1663)
<400> SEQUENCE: 11
caaagaagac tgtgacactc attaacctat tggtgcagat tttgtatgat ctaaaggaga 60
a atg ttc ttg gct gtt ttg tat tgc ctt ctg tgg agt ttc cag atc tct 109
Met Phe Leu Ala Val Leu Tyr Cys Leu Leu Trp Ser Phe Gln Ile Ser
1 5 10 15
gat ggc cat ttt cct cga gcc tgt gcc tcc tct aag aac ttg ttg gca 157
Asp Gly His Phe Pro Arg Ala Cys Ala Ser Ser Lys Asn Leu Leu Ala
20 25 30
aaa gaa tgc tgc cca cca tgg atg ggt gat ggg agt ccc tgc ggc cag 205
Lys Glu Cys Cys Pro Pro Trp Met Gly Asp Gly Ser Pro Cys Gly Gln
35 40 45
ctt tca ggc aga ggt tcc tgc cag gat atc ctt ctg tcc agt gca cca 253
Leu Ser Gly Arg Gly Ser Cys Gln Asp Ile Leu Leu Ser Ser Ala Pro
50 55 60
tct gga cct cag ttc ccc ttc aaa ggg gtg gat gac cgt gag tcc tgg 301
Ser Gly Pro Gln Phe Pro Phe Lys Gly Val Asp Asp Arg Glu Ser Trp
65 70 75 80
ccc tct gtg ttt tat aat agg acc tgc cag tgc tca ggc aac ttc atg 349
Pro Ser Val Phe Tyr Asn Arg Thr Cys Gln Cys Ser Gly Asn Phe Met
85 90 95
ggt ttc aac tgc gga aac tgt aag ttt gga ttt ggg ggc cca aat tgt 397
Gly Phe Asn Cys Gly Asn Cys Lys Phe Gly Phe Gly Gly Pro Asn Cys
100 105 110
aca gag aag cga gtc ttg att aga aga aac att ttt gat ttg agt gtc 445
Thr Glu Lys Arg Val Leu Ile Arg Arg Asn Ile Phe Asp Leu Ser Val
115 120 125
tcc gaa aag aat aag ttc ttt tct tac ctc act tta gca aaa cat act 493
Ser Glu Lys Asn Lys Phe Phe Ser Tyr Leu Thr Leu Ala Lys His Thr
130 135 140
atc agc tca gtc tat gtc atc ccc aca ggc acc tat ggc caa atg aac 541
Ile Ser Ser Val Tyr Val Ile Pro Thr Gly Thr Tyr Gly Gln Met Asn
145 150 155 160
aat ggg tca aca ccc atg ttt aat gat atc aac atc tac gac ctc ttt 589
Asn Gly Ser Thr Pro Met Phe Asn Asp Ile Asn Ile Tyr Asp Leu Phe
165 170 175
gta tgg atg cat tac tat gtg tca agg gac aca ctg ctt ggg ggc tct 637
Val Trp Met His Tyr Tyr Val Ser Arg Asp Thr Leu Leu Gly Gly Ser
180 185 190
gaa ata tgg agg gac att gat ttt gcc cat gaa gca cca ggg ttt ctg 685
Glu Ile Trp Arg Asp Ile Asp Phe Ala His Glu Ala Pro Gly Phe Leu
195 200 205
cct tgg cac aga ctt ttc ttg tta ttg tgg gaa caa gaa att cga gaa 733
Pro Trp His Arg Leu Phe Leu Leu Leu Trp Glu Gln Glu Ile Arg Glu
210 215 220
cta act ggg gat gag aac ttc act gtt cca tac tgg gat tgg aga gat 781
Leu Thr Gly Asp Glu Asn Phe Thr Val Pro Tyr Trp Asp Trp Arg Asp
225 230 235 240
gca gaa aac tgt gac att tgc aca gat gag tac ttg gga ggt cgt cac 829
Ala Glu Asn Cys Asp Ile Cys Thr Asp Glu Tyr Leu Gly Gly Arg His
245 250 255
cct gaa aat cct aac tta ctc agc cca gca tcc ttc ttc tcc tcc tgg 877
Pro Glu Asn Pro Asn Leu Leu Ser Pro Ala Ser Phe Phe Ser Ser Trp
260 265 270
cag atc att tgt agc aga tca gaa gag tat aat agc cat cag gtt tta 925
Gln Ile Ile Cys Ser Arg Ser Glu Glu Tyr Asn Ser His Gln Val Leu
275 280 285
tgc gat gga aca cct gag gga cca cta tta cgt aat cct gga aac cat 973
Cys Asp Gly Thr Pro Glu Gly Pro Leu Leu Arg Asn Pro Gly Asn His
290 295 300
gac aaa gcc aaa acc ccc agg ctc cca tct tca gca gat gtg gaa ttt 1021
Asp Lys Ala Lys Thr Pro Arg Leu Pro Ser Ser Ala Asp Val Glu Phe
305 310 315 320
tgt ctg agt ttg acc cag tat gaa tct gga tca atg gat aga act gcc 1069
Cys Leu Ser Leu Thr Gln Tyr Glu Ser Gly Ser Met Asp Arg Thr Ala
325 330 335
aat ttc agc ttt aga aac aca ctg gaa gga ttt gcc agt cca ctc aca 1117
Asn Phe Ser Phe Arg Asn Thr Leu Glu Gly Phe Ala Ser Pro Leu Thr
340 345 350
ggg ata gca gat cct tct caa agt agc atg cac aat gcc tta cat atc 1165
Gly Ile Ala Asp Pro Ser Gln Ser Ser Met His Asn Ala Leu His Ile
355 360 365
ttt atg aat gga aca atg tcc caa gta cag gga tcg gcc aac gat ccc 1213
Phe Met Asn Gly Thr Met Ser Gln Val Gln Gly Ser Ala Asn Asp Pro
370 375 380
att ttt ctt ctt cac cat gct ttt gtg gac agt att ttt gaa caa tgg 1261
Ile Phe Leu Leu His His Ala Phe Val Asp Ser Ile Phe Glu Gln Trp
385 390 395 400
ctg cga agg cac cgc cct ctt ttg gaa gtt tac cca gaa gcc aat gca 1309
Leu Arg Arg His Arg Pro Leu Leu Glu Val Tyr Pro Glu Ala Asn Ala
405 410 415
cct atc ggc cat aac aga gac tct tac atg gtt cct ttc ata ccg ctc 1357
Pro Ile Gly His Asn Arg Asp Ser Tyr Met Val Pro Phe Ile Pro Leu
420 425 430
tat aga aat ggt gat ttc ttc ata aca tcc aag gat ctg gga tat gac 1405
Tyr Arg Asn Gly Asp Phe Phe Ile Thr Ser Lys Asp Leu Gly Tyr Asp
435 440 445
tac agc tac ctc caa gag tca gat cca ggc ttt tac aga aat tat att 1453
Tyr Ser Tyr Leu Gln Glu Ser Asp Pro Gly Phe Tyr Arg Asn Tyr Ile
450 455 460
gag cct tac ttg gaa caa gcc agt cgt atc tgg cca tgg ctt ctt ggg 1501
Glu Pro Tyr Leu Glu Gln Ala Ser Arg Ile Trp Pro Trp Leu Leu Gly
465 470 475 480
gca gca ctg gtg gga gct gtt att gct gca gct ctc tct ggg ctt agc 1549
Ala Ala Leu Val Gly Ala Val Ile Ala Ala Ala Leu Ser Gly Leu Ser
485 490 495
agt agg cta tgc ctt cag aag aag aag aag aag aag caa ccc cag gag 1597
Ser Arg Leu Cys Leu Gln Lys Lys Lys Lys Lys Lys Gln Pro Gln Glu
500 505 510
gaa agg cag cca ctc ctc atg gac aaa gac gac tac cac agc ttg ctg 1645
Glu Arg Gln Pro Leu Leu Met Asp Lys Asp Asp Tyr His Ser Leu Leu
515 520 525
tat cag agc cat ctg tga acatcctagg aaacagagtg ggactgaaag 1693
Tyr Gln Ser His Leu *
530
gttttacctc actcgaccta tttgttggtg tttctacaaa tttaaactag tataaaacat 1753
agaccatagc tgtttggctt tttttcagac ccatgttttt tcctaagtcc tagtttctaa 1813
gaaatgactg ggatttgcta aaatatatat atatataaat aataacttac taatagctaa 1873
ataaaatttc ctcttacaac taattgagct ggtttttatg aatgtgtctt aattatttaa 1933
acttgaggca catttttgtt ttccttactt cattgtgaat ttccaagaaa aatattctct 1993
ctctctctct ctctcgtgtg tttgtgtgta tgtgtgtgtt aactgattca aacaattttg 2053
aaaatcttgg attgatagaa atgattcatt aatttatgaa attatttcat taatgattag 2113
gaaagacgaa taattactaa attagtaaca gaggagaaca tctgccagct tttaattaaa 2173
ttgtcattta agttacctta tctaccttct gtgactggtg gaaaaatatc aggcaagaga 2233
tgggaatgct ctgcctaata ggatagtggc tcctggaagg agtgggttat tactagagat 2293
tattacctga agtttaccat agttagaaaa ttaatcaaaa cagatgactc agtaacatct 2353
gaagcttcaa gtcggcttga ctgcaatctg aaatcatcaa gcccaagagc caaaggaatg 2413
ggaacagcga tgggaaacta tctgaatcag attctagtgt gatagtgtca ggggcacatg 2473
ggtcatcttt gagaccttca cacctgttga gtcaccaaaa tttgctgtga atgtaaattt 2533
ttactgtaaa ttaatttttt cttttctttt taaaaagatt tatttattat tatacataag 2593
tacactgtag ctgtcttcag acacaccaga agagggtgtc agatctcatt acagatggtt 2653
gtgagccacc atgtggttgc tgggatttga actcaggacc tctggaagaa cagtcagtgc 2713
tcttacccgc tgagccatct cgccagtccc agtaaatttt tactttagtg aaagtaaaat 2773
ttaagtttta gtttttagtt tagtaaaatt ttaggaagca aatttttagt tttctaaact 2833
aatttttttt tctagtactg gacatcaacc cagtgccttg tatatgcaat gcaagcattt 2893
tcttgtactc tgctacctag catgtatata taaatctacc caacaaatgt tcattacagc 2953
tgacaagggt ctttataaac tcagtgtttc cctttatcac aatacaattc cctcctttgc 3013
cacttcatgt catcatagaa tattgttttt ttctctagcg gttcaaggta tgtatttgta 3073
tagcagtcac acctttgata aaagttacca tctctttgat tatatatctc attatggtaa 3133
caaaattata ttatgactat ttcaatatat ctgaaagttt cattaaattc tcattaactt 3193
tgtatatttc agtcttgctt attgtgaagc ttttataaat tgcttcactt tttttctgaa 3253
attgtcctgt tgctacatca ttctgttaag aaataaataa gtggcaatat tttcc 3308
<210> SEQ ID NO 12
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: PCR Primer
<400> SEQUENCE: 12
tcgagcctgt gcctcctcta 20
<210> SEQ ID NO 13
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: PCR Primer
<400> SEQUENCE: 13
gactcccatc acccatccat 20
<210> SEQ ID NO 14
<211> LENGTH: 25
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: PCR Probe
<400> SEQUENCE: 14
ttgttggcaa aagaatgctg cccac 25
<210> SEQ ID NO 15
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: PCR Primer
<400> SEQUENCE: 15
ggcaaattca acggcacagt 20
<210> SEQ ID NO 16
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: PCR Primer
<400> SEQUENCE: 16
gggtctcgct cctggaagat 20
<210> SEQ ID NO 17
<211> LENGTH: 27
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: PCR Probe
<400> SEQUENCE: 17
aaggccgaga atgggaagct tgtcatc 27
<210> SEQ ID NO 18
<220> FEATURE:
<400> SEQUENCE: 18
000
<210> SEQ ID NO 19
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 19
cctctgcctg aaagctggcc 20
<210> SEQ ID NO 20
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 20
tggcaggtcc tattataaaa 20
<210> SEQ ID NO 21
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 21
tcatgggcaa aatcaatgtc 20
<210> SEQ ID NO 22
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 22
ctggtgcttc atgggcaaaa 20
<210> SEQ ID NO 23
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 23
tcatctgtgc aaatgtcaca 20
<210> SEQ ID NO 24
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 24
ggctgagtaa gttaggattt 20
<210> SEQ ID NO 25
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 25
tcatggtttc caggattacg 20
<210> SEQ ID NO 26
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 26
tctaaagctg aaattggcag 20
<210> SEQ ID NO 27
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 27
gggacattgt tccattcata 20
<210> SEQ ID NO 28
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 28
ctctattgcc taagcctttt 20
<210> SEQ ID NO 29
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 29
ttgcaaatga gaggtagtgt 20
<210> SEQ ID NO 30
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 30
gacctaagca aacccagtta 20
<210> SEQ ID NO 31
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 31
attcttatgg ttagaatatt 20
<210> SEQ ID NO 32
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 32
ctggctaatt ggagtcacag 20
<210> SEQ ID NO 33
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 33
tggccctact ctattgccta 20
<210> SEQ ID NO 34
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 34
ttagagtgag gtcaggcttt 20
<210> SEQ ID NO 35
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 35
ggaaaatgtt aaaagggctg 20
<210> SEQ ID NO 36
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 36
gttcctcatt accaaatagc 20
<210> SEQ ID NO 37
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 37
gagaccataa agaggctaca 20
<210> SEQ ID NO 38
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 38
tgtcaggaat agagcttctc 20
<210> SEQ ID NO 39
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 39
ctctgaaaag cacatgactg 20
<210> SEQ ID NO 40
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 40
cacatgtctt ggctgagacc 20
<210> SEQ ID NO 41
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 41
gagcactggc aggtcctatt 20
<210> SEQ ID NO 42
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 42
gatgctgggc tgagtaagtt 20
<210> SEQ ID NO 43
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 43
gccttttata aatggctctg 20
<210> SEQ ID NO 44
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 44
gttggaagaa ggctacactt 20
<210> SEQ ID NO 45
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 45
ctacctgagt tggaagaagg 20
<210> SEQ ID NO 46
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 46
ctgagtgaaa acagcaagac 20
<210> SEQ ID NO 47
<211> LENGTH: 480
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 47
agttctgaag aaaaattttt gacaaaatga gttctataaa tgttattgtc tacttatgat 60
ctctaaatac aacaggcttg tattcagaat ctagatgttt catgaccttt attcataaga 120
gatgatgtat tcttgatact acttctcatt tgcaaattcc aattattatt aatttcatat 180
caattagaat aatatatctt ccttcaattt agttacctca ctatgggcta tgtacaaact 240
ccaagaaaaa gttagtcatg tgctttgcag aagataaaag cttagtgtaa aacaggctga 300
gagtatttga tgtaagaagg ggagtggtta tataggtctt agccaaaaca tgtgatagtc 360
actccagggg ttgctggaaa agaagtctgt gacactcatt aacctattgg tgcagatttt 420
gtatgatcta aaggagaaa atg ttc ttg gct gtt ttg tat tgc ctt ctg tgg 472
agtttcca 480
<210> SEQ ID NO 48
<211> LENGTH: 1838
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<220> FEATURE:
<221> NAME/KEY: CDS
<222> LOCATION: (65)...(1411)
<400> SEQUENCE: 48
ggaaaagaag tctgtgacac tcattaacct attggtgcag attttgtatg atctaaagga 60
gaaa atg ttc ttg gct gtt ttg tat tgc ctt ctg tgg agt ttc cag atc 109
Met Phe Leu Ala Val Leu Tyr Cys Leu Leu Trp Ser Phe Gln Ile
1 5 10 15
tct gat ggc cat ttt cct cga gcc tgt gcc tcc tct aag aac ttg ttg 157
Ser Asp Gly His Phe Pro Arg Ala Cys Ala Ser Ser Lys Asn Leu Leu
20 25 30
gca aaa gaa tgc tgc cca cca tgg atg ggt gat ggg agt ccc tgc ggc 205
Ala Lys Glu Cys Cys Pro Pro Trp Met Gly Asp Gly Ser Pro Cys Gly
35 40 45
cag ctt tca ggc aga ggt tcc tgc cag gat atc ctt ctg tcc agt gca 253
Gln Leu Ser Gly Arg Gly Ser Cys Gln Asp Ile Leu Leu Ser Ser Ala
50 55 60
cca tct gga cct cag ttc ccc ttc aaa ggg gtg gat gac cgt gag tcc 301
Pro Ser Gly Pro Gln Phe Pro Phe Lys Gly Val Asp Asp Arg Glu Ser
65 70 75
tgg ccc tct gtg ttt tat aat agg acc tgc cag tgc tca ggc aac ttc 349
Trp Pro Ser Val Phe Tyr Asn Arg Thr Cys Gln Cys Ser Gly Asn Phe
80 85 90 95
atg ggt ttc aac tgc gga aac tgt aag ttt gga ttt ggg ggc cca aat 397
Met Gly Phe Asn Cys Gly Asn Cys Lys Phe Gly Phe Gly Gly Pro Asn
100 105 110
tgt aca gag aag cga gtc ttg att aga aga aac att ttt gat ttg agt 445
Cys Thr Glu Lys Arg Val Leu Ile Arg Arg Asn Ile Phe Asp Leu Ser
115 120 125
gtc tcc gaa aag aat aag ttc ttt tct tac ctc act tta gca aaa cat 493
Val Ser Glu Lys Asn Lys Phe Phe Ser Tyr Leu Thr Leu Ala Lys His
130 135 140
act atc agc tca gtc tat gtc atc ccc aca ggc acc tat ggc caa atg 541
Thr Ile Ser Ser Val Tyr Val Ile Pro Thr Gly Thr Tyr Gly Gln Met
145 150 155
aac aat ggg tca aca ccc atg ttt aat gat atc aac atc tac gac ctc 589
Asn Asn Gly Ser Thr Pro Met Phe Asn Asp Ile Asn Ile Tyr Asp Leu
160 165 170 175
ttt gta tgg atg cat tac tat gtg tca agg gac aca ctg ctt ggg ggc 637
Phe Val Trp Met His Tyr Tyr Val Ser Arg Asp Thr Leu Leu Gly Gly
180 185 190
tct gaa ata tgg agg gac att gat ttt gcc cat gaa gca cca ggg ttt 685
Ser Glu Ile Trp Arg Asp Ile Asp Phe Ala His Glu Ala Pro Gly Phe
195 200 205
ctg cct tgg cac aga ctt ttc ttg tta ttg tgg gaa caa gaa att cga 733
Leu Pro Trp His Arg Leu Phe Leu Leu Leu Trp Glu Gln Glu Ile Arg
210 215 220
gaa cta act ggg gat gag aac ttc act gtt cca tac tgg gat tgg aga 781
Glu Leu Thr Gly Asp Glu Asn Phe Thr Val Pro Tyr Trp Asp Trp Arg
225 230 235
gat gca gaa aac tgt gac att tgc aca gat gag tac ttg gga ggt cgt 829
Asp Ala Glu Asn Cys Asp Ile Cys Thr Asp Glu Tyr Leu Gly Gly Arg
240 245 250 255
cac cct gaa aat cct aac tta ctc agc cca gca tcc ttc ttc tcc tcc 877
His Pro Glu Asn Pro Asn Leu Leu Ser Pro Ala Ser Phe Phe Ser Ser
260 265 270
tgg cag atc att tgt agc aga tca gaa gag tat aat agc cat cag gtt 925
Trp Gln Ile Ile Cys Ser Arg Ser Glu Glu Tyr Asn Ser His Gln Val
275 280 285
tta tgc gat gga aca cct gag gga cca cta tta cgt aat cct gga aac 973
Leu Cys Asp Gly Thr Pro Glu Gly Pro Leu Leu Arg Asn Pro Gly Asn
290 295 300
cat gac aaa gcc aaa acc ccc agg ctc cca tct tca gca gat gtg gaa 1021
His Asp Lys Ala Lys Thr Pro Arg Leu Pro Ser Ser Ala Asp Val Glu
305 310 315
ttt tgt ctg agt ttg acc cag tat gaa tct gga tca atg gat aga act 1069
Phe Cys Leu Ser Leu Thr Gln Tyr Glu Ser Gly Ser Met Asp Arg Thr
320 325 330 335
gcc aat ttc agc ttt aga aac aca ctg gaa gta ttt ttg ttt gaa cac 1117
Ala Asn Phe Ser Phe Arg Asn Thr Leu Glu Val Phe Leu Phe Glu His
340 345 350
aat ggc tgc gaa ggg cac cgc cct ctt ttg gaa gtt tac cca gaa gcc 1165
Asn Gly Cys Glu Gly His Arg Pro Leu Leu Glu Val Tyr Pro Glu Ala
355 360 365
aat gca cct atc ggc cat aac aga gac tct tac atg gtt cct ttc ata 1213
Asn Ala Pro Ile Gly His Asn Arg Asp Ser Tyr Met Val Pro Phe Ile
370 375 380
ccg ctc tat aga aat ggt gat ttc ttc ata aca tcc aag gat ctg gga 1261
Pro Leu Tyr Arg Asn Gly Asp Phe Phe Ile Thr Ser Lys Asp Leu Gly
385 390 395
tat gac tac agc tac ctc caa gag tca gat cca ggc ttt tac aga aat 1309
Tyr Asp Tyr Ser Tyr Leu Gln Glu Ser Asp Pro Gly Phe Tyr Arg Asn
400 405 410 415
tat att gag cct tac ttg gaa caa ggc cag tcg tat ctg gcc atg gct 1357
Tyr Ile Glu Pro Tyr Leu Glu Gln Gly Gln Ser Tyr Leu Ala Met Ala
420 425 430
tct tgg ggc agc act ggt ggg agc tgt tat tgc tgc agc tct ctc tgg 1405
Ser Trp Gly Ser Thr Gly Gly Ser Cys Tyr Cys Cys Ser Ser Leu Trp
435 440 445
gct tag cagtaggcta tgccttcaga agaagaagaa gaagaagcaa ccccaggagg 1461
Ala
aaaggcagcc actcctcatg gacaaagacg actaccacag cttgctgtat cagagccatc 1521
tgtgaacatc ctaggaaaca gagtggactg aaaggtttta cctcactcga cctatttgtt 1581
ggtgtttcta caaatttaaa ctagcataaa acatagacca tagctgtttg gctttttttc 1641
agacccatgt tttttcctaa gtcctagttt ctaagaaatg actgggattt gctaaaatat 1701
atatatatat aaataataac ttactaatag ctaaataaaa tttcctctta caactaattg 1761
agtggttttt atgaatgtgt cttaattatt taaacttgag gcacattttt gttttcctta 1821
cttcattgtg aatttcc 1838
<210> SEQ ID NO 49
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 49
gaacatttct cctttagatc 20
<210> SEQ ID NO 50
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 50
agccaagaac atttctcctt 20
<210> SEQ ID NO 51
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 51
ggccatcaga gatctggaaa 20
<210> SEQ ID NO 52
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 52
ctcgaggaaa atggccatca 20
<210> SEQ ID NO 53
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 53
ttgccaacaa gttcttagag 20
<210> SEQ ID NO 54
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 54
aggaacctct gcctgaaagc 20
<210> SEQ ID NO 55
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 55
acagagggcc aggactcacg 20
<210> SEQ ID NO 56
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 56
agcactggca ggtcctatta 20
<210> SEQ ID NO 57
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 57
ttccgcagtt gaaacccatg 20
<210> SEQ ID NO 58
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 58
gggcccccaa atccaaactt 20
<210> SEQ ID NO 59
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 59
acaatttggg cccccaaatc 20
<210> SEQ ID NO 60
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 60
agtatgtttt gctaaagtga 20
<210> SEQ ID NO 61
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 61
gagctgatag tatgttttgc 20
<210> SEQ ID NO 62
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 62
ggatgacata gactgagctg 20
<210> SEQ ID NO 63
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 63
atttggccat aggtgcctgt 20
<210> SEQ ID NO 64
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 64
ggtgttgacc cattgttcat 20
<210> SEQ ID NO 65
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 65
tgtgtccctt gacacatagt 20
<210> SEQ ID NO 66
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 66
gtgcttcatg ggcaaaatca 20
<210> SEQ ID NO 67
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 67
aagaaaagtc tgtgccaagg 20
<210> SEQ ID NO 68
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 68
ttctcatccc cagttagttc 20
<210> SEQ ID NO 69
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 69
tgctgggctg agtaagttag 20
<210> SEQ ID NO 70
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 70
gatctgctac aaatgatctg 20
<210> SEQ ID NO 71
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 71
atggctatta tactcttctg 20
<210> SEQ ID NO 72
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 72
atccagattc atactgggtc 20
<210> SEQ ID NO 73
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 73
ttgtgcatgc tactttgaga 20
<210> SEQ ID NO 74
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 74
aaggcattgt gcatgctact 20
<210> SEQ ID NO 75
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 75
cattcataaa gatatgtaag 20
<210> SEQ ID NO 76
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 76
gtccacaaaa gcatggtgaa 20
<210> SEQ ID NO 77
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 77
gataggtgca ttggcttctg 20
<210> SEQ ID NO 78
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 78
tgaaaggaac catgtaagag 20
<210> SEQ ID NO 79
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 79
gatccttgga tgttatgaag 20
<210> SEQ ID NO 80
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 80
tagctgtagt catatcccag 20
<210> SEQ ID NO 81
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 81
tataatttct gtaaaagcct 20
<210> SEQ ID NO 82
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 82
gccccaagaa gccatggcca 20
<210> SEQ ID NO 83
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 83
gcccagagag agctgcagca 20
<210> SEQ ID NO 84
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 84
agctgtggta gtcgtctttg 20
<210> SEQ ID NO 85
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 85
taggatgttc acagatggct 20
<210> SEQ ID NO 86
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 86
tcccactctg tttcctagga 20
<210> SEQ ID NO 87
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 87
atatatttta gcaaatccca 20
<210> SEQ ID NO 88
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 88
aggaaatttt atttagctat 20
<210> SEQ ID NO 89
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 89
aaaaccagct caattagttg 20
<210> SEQ ID NO 90
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 90
gcctcaagtt taaataatta 20
<210> SEQ ID NO 91
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 91
aatgtgcctc aagtttaaat 20
<210> SEQ ID NO 92
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 92
tcttggaaat tcacaatgaa 20
<210> SEQ ID NO 93
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 93
caagattttc aaaattgttt 20
<210> SEQ ID NO 94
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 94
ctttcctaat cattaatgaa 20
<210> SEQ ID NO 95
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 95
cctgatattt ttccaccagt 20
<210> SEQ ID NO 96
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 96
tttcagattg cagtcaagcc 20
<210> SEQ ID NO 97
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 97
gctgttccca ttcctttggc 20
<210> SEQ ID NO 98
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 98
cctgacacta tcacactaga 20
<210> SEQ ID NO 99
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 99
caacaggtgt gaaggtctca 20
<210> SEQ ID NO 100
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 100
gtgactcaac aggtgtgaag 20
<210> SEQ ID NO 101
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 101
cagtaaaaat ttacattcac 20
<210> SEQ ID NO 102
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 102
gcttcctaaa attttactaa 20
<210> SEQ ID NO 103
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 103
aaactaaaaa tttgcttcct 20
<210> SEQ ID NO 104
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 104
cttgcattgc atatacaagg 20
<210> SEQ ID NO 105
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 105
agaaaatgct tgcattgcat 20
<210> SEQ ID NO 106
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 106
atatatacat gctaggtagc 20
<210> SEQ ID NO 107
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 107
ataaagaccc ttgtcagctg 20
<210> SEQ ID NO 108
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 108
atacatacct tgaaccgcta 20
<210> SEQ ID NO 109
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 109
tatacaaata cataccttga 20
<210> SEQ ID NO 110
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 110
ttaccataat gagatatata 20
<210> SEQ ID NO 111
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 111
cagatatatt gaaatagtca 20
<210> SEQ ID NO 112
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 112
tgagaattta atgaaacttt 20
<210> SEQ ID NO 113
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 113
tttcttaaca gaatgatgta 20
<210> SEQ ID NO 114
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 114
catttataga actcattttg 20
<210> SEQ ID NO 115
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 115
cttatgaata aaggtcatga 20
<210> SEQ ID NO 116
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 116
tttatcttct gcaaagcaca 20
<210> SEQ ID NO 117
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 117
gttcaaacaa aaatacttcc 20
<210> SEQ ID NO 118
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 118
ggccagcuuu caggcagagg 20
<210> SEQ ID NO 119
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 119
uuuuauaaua ggaccugcca 20
<210> SEQ ID NO 120
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 120
gacauugauu uugcccauga 20
<210> SEQ ID NO 121
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 121
uuuugcccau gaagcaccag 20
<210> SEQ ID NO 122
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 122
ugugacauuu gcacagauga 20
<210> SEQ ID NO 123
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 123
aaauccuaac uuacucagcc 20
<210> SEQ ID NO 124
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 124
cguaauccug gaaaccauga 20
<210> SEQ ID NO 125
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 125
cugccaauuu cagcuuuaga 20
<210> SEQ ID NO 126
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 126
uaugaaugga acaauguccc 20
<210> SEQ ID NO 127
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 127
cugugacucc aauuagccag 20
<210> SEQ ID NO 128
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 128
uaggcaauag aguagggcca 20
<210> SEQ ID NO 129
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 129
aaagccugac cucacucuaa 20
<210> SEQ ID NO 130
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 130
cagcccuuuu aacauuuucc 20
<210> SEQ ID NO 131
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 131
gcuauuuggu aaugaggaac 20
<210> SEQ ID NO 132
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 132
aauaggaccu gccagugcuc 20
<210> SEQ ID NO 133
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 133
aacuuacuca gcccagcauc 20
<210> SEQ ID NO 134
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 134
cagagccauu uauaaaaggc 20
<210> SEQ ID NO 135
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 135
aaguguagcc uucuuccaac 20
<210> SEQ ID NO 136
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 136
ccuucuucca acucagguag 20
<210> SEQ ID NO 137
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 137
gucuugcugu uuucacucag 20
<210> SEQ ID NO 138
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 138
aaggagaaau guucuuggcu 20
<210> SEQ ID NO 139
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 139
uuuccagauc ucugauggcc 20
<210> SEQ ID NO 140
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 140
ugauggccau uuuccucgag 20
<210> SEQ ID NO 141
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 141
cucuaagaac uuguuggcaa 20
<210> SEQ ID NO 142
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 142
gcuuucaggc agagguuccu 20
<210> SEQ ID NO 143
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 143
cgugaguccu ggcccucugu 20
<210> SEQ ID NO 144
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 144
uaauaggacc ugccagugcu 20
<210> SEQ ID NO 145
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 145
cauggguuuc aacugcggaa 20
<210> SEQ ID NO 146
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 146
aaguuuggau uugggggccc 20
<210> SEQ ID NO 147
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 147
gauuuggggg cccaaauugu 20
<210> SEQ ID NO 148
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 148
ucacuuuagc aaaacauacu 20
<210> SEQ ID NO 149
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 149
gcaaaacaua cuaucagcuc 20
<210> SEQ ID NO 150
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 150
cagcucaguc uaugucaucc 20
<210> SEQ ID NO 151
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 151
acaggcaccu auggccaaau 20
<210> SEQ ID NO 152
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 152
ugauuuugcc caugaagcac 20
<210> SEQ ID NO 153
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 153
cuaacuuacu cagcccagca 20
<210> SEQ ID NO 154
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 154
cagaucauuu guagcagauc 20
<210> SEQ ID NO 155
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 155
cagaagagua uaauagccau 20
<210> SEQ ID NO 156
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 156
gacccaguau gaaucuggau 20
<210> SEQ ID NO 157
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 157
ucucaaagua gcaugcacaa 20
<210> SEQ ID NO 158
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 158
aguagcaugc acaaugccuu 20
<210> SEQ ID NO 159
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 159
uucaccaugc uuuuguggac 20
<210> SEQ ID NO 160
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 160
cagaagccaa ugcaccuauc 20
<210> SEQ ID NO 161
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 161
cugggauaug acuacagcua 20
<210> SEQ ID NO 162
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 162
aggcuuuuac agaaauuaua 20
<210> SEQ ID NO 163
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 163
uggccauggc uucuuggggc 20
<210> SEQ ID NO 164
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 164
ugcugcagcu cucucugggc 20
<210> SEQ ID NO 165
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 165
caaagacgac uaccacagcu 20
<210> SEQ ID NO 166
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 166
agccaucugu gaacauccua 20
<210> SEQ ID NO 167
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 167
uccuaggaaa cagaguggga 20
<210> SEQ ID NO 168
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 168
ugggauuugc uaaaauauau 20
<210> SEQ ID NO 169
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 169
auagcuaaau aaaauuuccu 20
<210> SEQ ID NO 170
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 170
uucauuguga auuuccaaga 20
<210> SEQ ID NO 171
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 171
uucauuaaug auuaggaaag 20
<210> SEQ ID NO 172
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 172
acugguggaa aaauaucagg 20
<210> SEQ ID NO 173
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 173
ggcuugacug caaucugaaa 20
<210> SEQ ID NO 174
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 174
gccaaaggaa ugggaacagc 20
<210> SEQ ID NO 175
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 175
ugagaccuuc acaccuguug 20
<210> SEQ ID NO 176
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 176
cuucacaccu guugagucac 20
<210> SEQ ID NO 177
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 177
uuaguaaaau uuuaggaagc 20
<210> SEQ ID NO 178
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 178
ccuuguauau gcaaugcaag 20
<210> SEQ ID NO 179
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 179
augcaaugca agcauuuucu 20
<210> SEQ ID NO 180
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 180
gcuaccuagc auguauauau 20
<210> SEQ ID NO 181
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 181
cagcugacaa gggucuuuau 20
<210> SEQ ID NO 182
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 182
uagcgguuca agguauguau 20
<210> SEQ ID NO 183
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 183
ugacuauuuc aauauaucug 20
<210> SEQ ID NO 184
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 184
uacaucauuc uguuaagaaa 20
1.PublishNumber: US-2004215006-A1
2.Date Publish: 20041028
3.Inventor: BENNETT C. FRANK
CONDON THOMAS
FREIER SUSAN M.
DOBIE KENNETH W.
4.Inventor Harmonized: BENNETT C FRANK(US)
CONDON THOMAS(US)
FREIER SUSAN M(US)
DOBIE KENNETH W(US)
5.Country: US
6.Claims:
(en)Compounds, compositions and methods are provided for modulating the expression of tyrosinase. The compositions comprise oligonucleotides, targeted to nucleic acid encoding tyrosinase. Methods of using these compounds for modulation of tyrosinase expression and for diagnosis and treatment of disease associated with expression of tyrosinase are provided.
7.Description:
(en)FIELD OF THE INVENTION
[0001] The present invention provides compositions and methods for modulating the expression of tyrosinase. In particular, this invention relates to compounds, particularly oligonucleotide compounds, which, in preferred embodiments, hybridize with nucleic acid molecules encoding tyrosinase. Such compounds are shown herein to modulate the expression of tyrosinase.
BACKGROUND OF THE INVENTION
[0002] The color of mammalian skin and hair is determined by a number of factors, the most important of which is the degree and distribution of melanin pigmentation. Melanin is formed in specialized pigment-producing cells known as melanocytes. Melanocytes originate in the neural crest during embryogenesis and are distributed through the embryo during its development. The migration pathways followed by the melanocytes are under strict genetic control. Melanocytes are biosynthesized in the membranous organelles named melanosomes. Mature melanosomes, located in the dendrites of melanocytes are then phagocytosed by the surrounding keratinocytes. This process is responsible for the variety of colors in human skin, hair, and eyes (Sanchez-Ferrer et al., Biochim. Biophys. Acta , 1995, 1247, 1-11).
[0003] Tyrosinase (also known as TYR and TYRL) is the key enzyme in the melanin biosynthetic pathway. Tyrosinase catalyzes the first two steps in the pathway for pigment synthesis: hydroxylation of the amino acid tyrosine into dihydroxyphenylalanine (DOPA) and then oxidation into dopaquinone. Mutations in the tyrosinase gene have been associated with oculocutaneous albinism type I (OCA1), an autosomal recessive disorder wherein the phenotype is a complete lack of melanin biosynthesis in the eyes, hair, and skin (Oetting, Pigment Cell Res ., 2000, 13, 320-325).
[0004] Tyrosinase is a type I integral membrane glycoprotein that contains 529 amino acids and can be divided into three domains: an inner domain that resides inside of melanosomes, a transmembrane domain, and a cytoplasmic domain that extends into the cytoplasm of melanocytes (Oetting, Pigment Cell Res ., 2000, 13, 320-325). The major portion of the enzyme is found inside the melanosome with only 10% (approximately 30 amino acids residues) acting as the cytoplasmic domain. Functionally, the inner domain is responsible for catalytic activity which is consistent with melanin formation occurring exclusively within melanosomes (Park and Gilchrest, Cell Mol. Biol . ( Noisy - le - grand ), 1999, 45, 919-930).
[0005] The tyrosinase locus maps to human chromosome 11q14-21 (Barton et al., Genomics , 1988, 3, 17-24). The gene contains five exons spanning more than 65 kb (Giebel et al., Genomics , 1991, 9, 435-445). The size of the introns range from 10 kb for intron 4 to over 30 kb for intron 2. Over 50% of the coding region is found in exon 1 (Oetting, Pigment Cell Res ., 2000, 13, 320-325).
[0006] Tyrosinase is an attractive target antigen for immunotherapeutic treatment of patients with melanoma because it is more homogeneously expressed than several other melanocyte differentiation antigens such as MART-1, gp100, or gp75. In two separate investigations, tyrosinase was found to be expressed in 100% of fresh melanoma specimens evaluated by immunohistochemistry or reverse transcription-polymerase chain reaction. These data indicate that tyrosinase may be an excellent target for essentially all patients with melanoma (Riley et al., J. Immunother ., 2001, 24, 212-220).
[0007] Tyrosinase has also been implicated in Vogt-Koyanagi-Harada (VKH) disease. VKH is a bilateral granulomatous panuveitis associated with central nervous system, auditory, and integumentary manifestations. It usually manifests with prodromal similar to asceptic meningitis, followed by posterior uveitis with exudative retinal detachments and disk hyperemia. T-cell clones established from patients with VKH disease and stimulated with tyrosinase family peptides demonstrated a predominantly proinflammatory, Th1-type T-cell response. Read et al. demonstrated that a VKH-like syndrome is inducible in rats by immunization with peptides derived from tyrosinase and other tyrosinase family proteins (Read et al., Curr. Opin. Ophthalmol ., 2000, 11, 437-442).
[0008] The involvement of tyrosinase in melanoma, and VKH disease make its selective inhibition an appropriate point for therapeutic intervention in these disorders.
[0009] Small molecule inhibitors are well known in the art, some examples of which include flavinoids, stilbenes, 4-substituted resorcinols, benzaldoximes and benzaldehyde-o-aldoximes (Ley and Bertram, Bioorg. Med. Chem ., 2001, 9, 1879-1885; Shimizu et al., Planta Med ., 2000, 66, 11-15).
[0010] Disclosed in U.S. Pat. No. 5,780,607 are antisense molecules demonstrated to reduce levels of the enzyme tyrosinase in melanocytes that have potential utility for treating several diseases of hyperpigmentation (Goodnow and Tam, 1998).
[0011] Disclosed and claimed in Chinese patent CN1293038 is a composition for medicines, beautifying products and cosmetics containing polynucleotide fragments of the tyrosinase coding gene or its mRNA, introduced to skin cells by liposome or other genes to prevent pigmentation in skin (He and Jiang, 2001). Also disclosed in Chinese patent CN1375277 is the addition of antisense oligodeoxynucleotide pointed to tyrosinase into skin cosmetics which can be used for beautifying and whitening skin (Fan and Huang, 2002).
[0012] Disclosed and claimed in PCT publication WO 01/58918 are antisense oligonucleotides targeting regions of the tyrosinase gene including the initiation codon, the coding region and the non-coding 3′ region for use as depigmentation or skin whitening agents in a cosmetic composition or a dermatological composition (Kurfurst and Joly, 2001).
[0013] Currently, there are no therapeutic agents inhibiting the synthesis of tyrosinase. To date, investigative strategies aimed at modulating tyrosinase function have involved the use of gene knockouts in mice, small molecule inhibitors and antisense molecules.
[0014] Antisense technology is emerging as an effective means for reducing the expression of specific gene products and may therefore prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications for the modulation of tyrosinase expression.
[0015] The present invention provides the compositions and methods for modulating tyrosinase expression.
SUMMARY OF THE INVENTION
[0016] The present invention is directed to compounds, especially nucleic acid and nucleic acid-like oligomers, which are targeted to a nucleic acid encoding tyrosinase, and which modulate the expression of tyrosinase. Pharmaceutical and other compositions comprising the compounds of the invention are also provided. Further provided are methods of screening for modulators of tyrosinase and methods of modulating the expression of tyrosinase in cells, tissues or animals comprising contacting said cells, tissues or animals with one or more of the compounds or compositions of the invention. Methods of treating an animal, particularly a human, suspected of having or being prone to a disease or condition associated with expression of tyrosinase are also set forth herein. Such methods comprise administering a therapeutically or prophylactically effective amount of one or more of the compounds or compositions of the invention to the person in need of treatment.
DETAILED DESCRIPTION OF THE INVENTION
A. Overview of the Invention
[0017] The present invention employs compounds, preferably oligonucleotides and similar species for use in modulating the function or effect of nucleic acid molecules encoding tyrosinase. This is accomplished by providing oligonucleotides which specifically hybridize with one or more nucleic acid molecules encoding tyrosinase. As used herein, the terms “target nucleic acid” and “nucleic acid molecule encoding tyrosinase” have been used for convenience to encompass DNA encoding tyrosinase, RNA (including pre-mRNA and mRNA or portions thereof) transcribed from such DNA, and also cDNA derived from such RNA. The hybridization of a compound of this invention with its target nucleic acid is generally referred to as “antisense”. Consequently, the preferred mechanism believed to be included in the practice of some preferred embodiments of the invention is referred to herein as “antisense inhibition.” Such antisense inhibition is typically based upon hydrogen bonding-based hybridization of oligonucleotide strands or segments such that at least one strand or segment is cleaved, degraded, or otherwise rendered inoperable. In this regard, it is presently preferred to target specific nucleic acid molecules and their functions for such antisense inhibition.
[0018] The functions of DNA to be interfered with can include replication and transcription. Replication and transcription, for example, can be from an endogenous cellular template, a vector, a plasmid construct or otherwise. The functions of RNA to be interfered with can include functions such as translocation of the RNA to a site of protein translation, translocation of the RNA to sites within the cell which are distant from the site of RNA synthesis, translation of protein from the RNA, splicing of the RNA to yield one or more RNA species, and catalytic activity or complex formation involving the RNA which may be engaged in or facilitated by the RNA. One preferred result of such interference with target nucleic acid function is modulation of the expression of tyrosinase. In the context of the present invention, “modulation” and “modulation of expression” mean either an increase (stimulation) or a decrease (inhibition) in the amount or levels of a nucleic acid molecule encoding the gene, e.g., DNA or RNA. Inhibition is often the preferred form of modulation of expression and mRNA is often a preferred target nucleic acid.
[0019] In the context of this invention, “hybridization” means the pairing of complementary strands of oligomeric compounds. In the present invention, the preferred mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases (nucleobases) of the strands of oligomeric compounds. For example, adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds. Hybridization can occur under varying circumstances.
[0020] An antisense compound is specifically hybridizable when binding of the compound to the target nucleic acid interferes with the normal function of the target nucleic acid to cause a loss of activity, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target nucleic acid sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or, therapeutic treatment, and under conditions in which assays are performed in the case of in vitro assays.
[0021] In the present invention the phrase “stringent hybridization conditions” or “stringent conditions” refers to conditions under which a compound of the invention will hybridize to its target sequence, but to a minimal number of other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances and in the context of this invention, “stringent conditions” under which oligomeric compounds hybridize to a target sequence are determined by the nature and composition of the oligomeric compounds and the assays in which they are being investigated.
[0022] “Complementary,” as used herein, refers to the capacity for precise pairing between two nucleobases of an oligomeric compound. For example, if a nucleobase at a certain position of an oligonucleotide (an oligomeric compound), is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, said target nucleic acid being a DNA, RNA, or oligonucleotide molecule, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be a complementary position. The oligonucleotide and the further DNA, RNA, or oligonucleotide molecule are complementary to each other when a sufficient number of complementary positions in each molecule are occupied by nucleobases which can hydrogen bond with each other. Thus, “specifically hybridizable” and “complementary” are terms which are used to indicate a sufficient degree of precise pairing or complementarity over a sufficient number of nucleobases such that stable and specific binding occurs between the oligonucleotide and a target nucleic acid.
[0023] It is understood in the art that the sequence of an antisense compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable. Moreover, an oligonucleotide may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure). It is preferred that the antisense compounds of the present invention comprise at least 70% sequence complementarity to a target region within the target nucleic acid, more preferably that they comprise 90% sequence complementarity and even more preferably comprise 95% sequence complementarity to the target region within the target nucleic acid sequence to which they are targeted. For example, an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, an antisense compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention. Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol ., 1990, 215, 403-410; Zhang and Madden, Genome Res ., 1997, 7, 649-656).
B. Compounds of the Invention
[0024] According to the present invention, compounds include antisense oligomeric compounds, antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, alternate splicers, primers, probes, and other oligomeric compounds which hybridize to at least a portion of the target nucleic acid. As such, these compounds may be introduced in the form of single-stranded, double-stranded, circular or hairpin oligomeric compounds and may contain structural elements such as internal or terminal bulges or loops. Once introduced to a system, the compounds of the invention may elicit the action of one or more enzymes or structural proteins to effect modification of the target nucleic acid. One non-limiting example of such an enzyme is RNAse H, a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. It is known in the art that single-stranded antisense compounds which are “DNA-like” elicit RNAse H. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide-mediated inhibition of gene expression. Similar roles have been postulated for other ribonucleases such as those in the RNase III and ribonuclease L family of enzymes.
[0025] While the preferred form of antisense compound is a single-stranded antisense oligonucleotide, in many species the introduction of double-stranded structures, such as double-stranded RNA (dsRNA) molecules, has been shown to induce potent and specific antisense-mediated reduction of the function of a gene or its associated gene products. This phenomenon occurs in both plants and animals and is believed to have an evolutionary connection to viral defense and transposon silencing.
[0026] The first evidence that dsRNA could lead to gene silencing in animals came in 1995 from work in the nematode, Caenorhabditis elegans (Guo and Kempheus, Cell , 1995, 81, 611-620). Montgomery et al. have shown that the primary interference effects of dsRNA are posttranscriptional (Montgomery et al., Proc. Natl. Acad. Sci. USA , 1998, 95, 15502-15507). The posttranscriptional antisense mechanism defined in Caenorhabditis elegans resulting from exposure to double-stranded RNA (dsRNA) has since been designated RNA interference (RNAi). This term has been generalized to mean antisense-mediated gene silencing involving the introduction of dsRNA leading to the sequence-specific reduction of endogenous targeted mRNA levels (Fire et al., Nature , 1998, 391, 806-811). Recently, it has been shown that it is, in fact, the single-stranded RNA oligomers of antisense polarity of the dsRNAs which are the potent inducers of RNAi (Tijsterman et al., Science , 2002, 295, 694-697).
[0027] In the context of this invention, the term “oligomeric compound” refers to a polymer or oligomer comprising a plurality of monomeric units. In the context of this invention, the term “oligonucleotide” refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics, chimeras, analogs and homologs thereof. This term includes oligonucleotides composed of naturally occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for a target nucleic acid and increased stability in the presence of nucleases.
[0028] While oligonucleotides are a preferred form of the compounds of this invention, the present invention comprehends other families of compounds as well, including but not limited to oligonucleotide analogs and mimetics such as those described herein.
[0029] The compounds in accordance with this invention preferably comprise from about 8 to about 80 nucleobases (i.e. from about 8 to about 80 linked nucleosides). One of ordinary skill in the art will appreciate that the invention embodies compounds of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 nucleobases in length.
[0030] In one preferred embodiment, the compounds of the invention are 12 to 50 nucleobases in length. One having ordinary skill in the art will appreciate that this embodies compounds of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleobases in length.
[0031] In another preferred embodiment, the compounds of the invention are 15 to 30 nucleobases in length. One having ordinary skill in the art will appreciate that this embodies compounds of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length.
[0032] Particularly preferred compounds are oligonucleotides from about 12 to about 50 nucleobases, even more preferably those comprising from about 15 to about 30 nucleobases.
[0033] Antisense compounds 8-80 nucleobases in length comprising a stretch of at least eight (8) consecutive nucleobases selected from within the illustrative antisense compounds are considered to be suitable antisense compounds as well.
[0034] Exemplary preferred antisense compounds include oligonucleotide sequences that comprise at least the 8 consecutive nucleobases from the 5′-terminus of one of the illustrative preferred antisense compounds (the remaining nucleobases being a consecutive stretch of the same oligonucleotide beginning immediately upstream of the 5′-terminus of the antisense compound which is specifically hybridizable to the target nucleic acid and continuing until the oligonucleotide contains about 8 to about 80 nucleobases). Similarly preferred antisense compounds are represented by oligonucleotide sequences that comprise at least the 8 consecutive nucleobases from the 3′-terminus of one of the illustrative preferred antisense compounds (the remaining nucleobases being a consecutive stretch of the same oligonucleotide beginning immediately downstream of the 3′-terminus of the antisense compound which is specifically hybridizable to the target nucleic acid and continuing until the oligonucleotide contains about 8 to about 80 nucleobases). One having skill in the art armed with the preferred antisense compounds illustrated herein will be able, without undue experimentation, to identify further preferred antisense compounds.
C. Targets of the Invention
[0035] “Targeting” an antisense compound to a particular nucleic acid molecule, in the context of this invention, can be a multistep process. The process usually begins with the identification of a target nucleic acid whose function is to be modulated. This target nucleic acid may be, for example, a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent. In the present invention, the target nucleic acid encodes tyrosinase.
[0036] The targeting process usually also includes determination of at least one target region, segment, or site within the target nucleic acid for the antisense interaction to occur such that the desired effect, e.g., modulation of expression, will result. Within the context of the present invention, the term “region” is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic within regions of target nucleic acids are segments. “Segments” are defined as smaller or sub-portions of regions within a target nucleic acid. “Sites,” as used in the present invention, are defined as positions within a target nucleic acid.
[0037] Since, as is known in the art, the translation initiation codon is typically 5′-AUG (in transcribed mRNA molecules; 5′-ATG in the corresponding DNA molecule), the translation initiation codon is also referred to as the “AUG codon,” the “start codon” or the “AUG start codon”. A minority of genes have a translation initiation codon having the RNA sequence 5′-GUG, 5′-UUG or 5′-CUG, and 5′-AUA, 5′-ACG and 5′-CUG have been shown to function in vivo. Thus, the terms “translation initiation codon” and “start codon” can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine (in eukaryotes) or formylmethionine (in prokaryotes). It is also known in the art that eukaryotic and prokaryotic genes may have two or more alternative start codons, any one of which may be preferentially utilized for translation initiation in a particular cell type or tissue, or under a particular set of conditions. In the context of the invention, “start codon” and “translation initiation codon” refer to the codon or codons that are used in vivo to initiate translation of an mRNA transcribed from a gene encoding tyrosinase, regardless of the sequence(s) of such codons. It is also known in the art that a translation termination codon (or “stop codon”) of a gene may have one of three sequences, i.e., 5′-UAA, 5′-UAG and 5′-UGA (the corresponding DNA sequences are 5′-TAA, 5′-TAG and 5′-TGA, respectively).
[0038] The terms “start codon region” and “translation initiation codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5′ or 3′) from a translation initiation codon. Similarly, the terms “stop codon region” and “translation termination codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5′ or 3′) from a translation termination codon. Consequently, the “start codon region” (or “translation initiation codon region”) and the “stop codon region” (or “translation termination codon region”) are all regions which may be targeted effectively with the antisense compounds of the present invention.
[0039] The open reading frame (ORF) or “coding region,” which is known in the art to refer to the region between the translation initiation codon and the translation termination codon, is also a region which may be targeted effectively. Within the context of the present invention, a preferred region is the intragenic region encompassing the translation initiation or termination codon of the open reading frame (ORF) of a gene.
[0040] Other target regions include the 5′ untranslated region (5′ UTR), known in the art to refer to the portion of an mRNA in the 5′ direction from the translation initiation codon, and thus including nucleotides between the 5′ cap site and the translation initiation codon of an mRNA (or corresponding nucleotides on the gene), and the 3′ untranslated region (3′ UTR), known in the art to refer to the portion of an mRNA in the 3′ direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3′ end of an mRNA (or corresponding nucleotides on the gene). The 5′ cap site of an mRNA comprises an N7-methylated guanosine residue joined to the 5′-most residue of the mRNA via a 5′-5′ triphosphate linkage. The 5′ cap region of an mRNA is considered to include the 5′ cap structure itself as well as the first 50 nucleotides adjacent to the cap site. It is also preferred to target the 5′ cap region.
[0041] Although some eukaryotic mRNA transcripts are directly translated, many contain one or more regions, known as “introns,” which are excised from a transcript before it is translated. The remaining (and therefore translated) regions are known as “exons” and are spliced together to form a continuous mRNA sequence. Targeting splice sites, i.e., intron-exon junctions or exon-intron junctions, may also be particularly useful in situations where aberrant splicing is implicated in disease, or where an overproduction of a particular splice product is implicated in disease. Aberrant fusion junctions due to rearrangements or deletions are also preferred target sites. mRNA transcripts produced via the process of splicing of two (or more) mRNAs from different gene sources are known as “fusion transcripts”. It is also known that introns can be effectively targeted using antisense compounds targeted to, for example, DNA or pre-mRNA.
[0042] It is also known in the art that alternative RNA transcripts can be produced from the same genomic region of DNA. These alternative transcripts are generally known as “variants”. More specifically, “pre-mRNA variants” are transcripts produced from the same genomic DNA that differ from other transcripts produced from the same genomic DNA in either their start or stop position and contain both intronic and exonic sequence.
[0043] Upon excision of one or more exon or intron regions, or portions thereof during splicing, pre-mRNA variants produce smaller “mRNA variants”. Consequently, mRNA variants are processed pre-mRNA variants and each unique pre-mRNA variant must always produce a unique mRNA variant as a result of splicing. These mRNA variants are also known as “alternative splice variants”. If no splicing of the pre-mRNA variant occurs then the pre-mRNA variant is identical to the mRNA variant.
[0044] It is also known in the art that variants can be produced through the use of alternative signals to start or stop transcription and that pre-mRNAs and mRNAs can possess more that one start codon or stop codon. Variants that originate from a pre-mRNA or mRNA that use alternative start codons are known as “alternative start variants” of that pre-mRNA or mRNA. Those transcripts that use an alternative stop codon are known as “alternative stop variants” of that pre-mRNA or mRNA. One specific type of alternative stop variant is the “polyA variant” in which the multiple transcripts produced result from the alternative selection of one of the “polyA stop signals” by the transcription machinery, thereby producing transcripts that terminate at unique polyA sites. Within the context of the invention, the types of variants described herein are also preferred target nucleic acids.
[0045] The locations on the target nucleic acid to which the preferred antisense compounds hybridize are hereinbelow referred to as “preferred target segments.” As used herein the term “preferred target segment” is defined as at least an 8-nucleobase portion of a target region to which an active antisense compound is targeted. While not wishing to be bound by theory, it is presently believed that these target segments represent portions of the target nucleic acid which are accessible for hybridization.
[0046] While the specific sequences of certain preferred target segments are set forth herein, one of skill in the art will recognize that these serve to illustrate and describe particular embodiments within the scope of the present invention. Additional preferred target segments may be identified by one having ordinary skill.
[0047] Target segments 8-80 nucleobases in length comprising a stretch of at least eight (8) consecutive nucleobases selected from within the illustrative preferred target segments are considered to be suitable for targeting as well.
[0048] Target segments can include DNA or RNA sequences that comprise at least the 8 consecutive nucleobases from the 5′-terminus of one of the illustrative preferred target segments (the remaining nucleobases being a consecutive stretch of the same DNA or RNA beginning immediately upstream of the 5′-terminus of the target segment and continuing until the DNA or RNA contains about 8 to about 80 nucleobases). Similarly preferred target segments are represented by DNA or RNA sequences that comprise at least the 8 consecutive nucleobases from the 3′-terminus of one of the illustrative preferred target segments (the remaining nucleobases being a consecutive stretch of the same DNA or RNA beginning immediately downstream of the 3′-terminus of the target segment and continuing until the DNA or RNA contains about 8 to about 80 nucleobases). One having skill in the art armed with the preferred target segments illustrated herein will be able, without undue experimentation, to identify further preferred target segments.
[0049] Once one or more target regions, segments or sites have been identified, antisense compounds are chosen which are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect.
D. Screening and Target Validation
[0050] In a further embodiment, the “preferred target segments” identified herein may be employed in a screen for additional compounds that modulate the expression of tyrosinase. “Modulators” are those compounds that decrease or increase the expression of a nucleic acid molecule encoding tyrosinase and which comprise at least an 8-nucleobase portion which is complementary to a preferred target segment. The screening method comprises the steps of contacting a preferred target segment of a nucleic acid molecule encoding tyrosinase with one or more candidate modulators, and selecting for one or more candidate modulators which decrease or increase the expression of a nucleic acid molecule encoding tyrosinase. Once it is shown that the candidate modulator or modulators are capable of modulating (e.g. either decreasing or increasing) the expression of a nucleic acid molecule encoding tyrosinase, the modulator may then be employed in further investigative studies of the function of tyrosinase, or for use as a research, diagnostic, or therapeutic agent in accordance with the present invention.
[0051] The preferred target segments of the present invention may be also be combined with their respective complementary antisense compounds of the present invention to form stabilized double-stranded (duplexed) oligonucleotides.
[0052] Such double stranded oligonucleotide moieties have been shown in the art to modulate target expression and regulate translation as well as RNA processsing via an antisense mechanism. Moreover, the double-stranded moieties may be subject to chemical modifications (Fire et al., Nature , 1998, 391, 806-811; Timmons and Fire, Nature 1998, 395, 854; Timmons et al., Gene , 2001, 263, 103-112; Tabara et al., Science , 1998, 282, 430-431; Montgomery et al., Proc. Natl. Acad. Sci. USA , 1998, 95, 15502-15507; Tuschl et al., Genes Dev ., 1999, 13, 3191-3197; Elbashir et al., Nature , 2001, 411, 494-498; Elbashir et al., Genes Dev . 2001, 15, 188-200). For example, such double-stranded moieties have been shown to inhibit the target by the classical hybridization of antisense strand of the duplex to the target, thereby triggering enzymatic degradation of the target (Tijsterman et al., Science , 2002, 295, 694-697).
[0053] The compounds of the present invention can also be applied in the areas of drug discovery and target validation. The present invention comprehends the use of the compounds and preferred target segments identified herein in drug discovery efforts to elucidate relationships that exist between tyrosinase and a disease state, phenotype, or condition. These methods include detecting or modulating tyrosinase comprising contacting a sample, tissue, cell, or organism with the compounds of the present invention, measuring the nucleic acid or protein level of tyrosinase and/or a related phenotypic or chemical endpoint at some time after treatment, and optionally comparing the measured value to a non-treated sample or sample treated with a further compound of the invention. These methods can also be performed in parallel or in combination with other experiments to determine the function of unknown genes for the process of target validation or to determine the validity of a particular gene product as a target for treatment or prevention of a particular disease, condition, or phenotype.
E. Kits, Research Reagents, Diagnostics, and Therapeutics
[0054] The compounds of the present invention can be utilized for diagnostics, therapeutics, prophylaxis and as research reagents and kits. Furthermore, antisense oligonucleotides, which are able to inhibit gene expression with exquisite specificity, are often used by those of ordinary skill to elucidate the function of particular genes or to distinguish between functions of various members of a biological pathway.
[0055] For use in kits and diagnostics, the compounds of the present invention, either alone or in combination with other compounds or therapeutics, can be used as tools in differential and/or combinatorial analyses to elucidate expression patterns of a portion or the entire complement of genes expressed within cells and tissues.
[0056] As one nonlimiting example, expression patterns within cells or tissues treated with one or more antisense compounds are compared to control cells or tissues not treated with antisense compounds and the patterns produced are analyzed for differential levels of gene expression as they pertain, for example, to disease association, signaling pathway, cellular localization, expression level, size, structure or function of the genes examined. These analyses can be performed on stimulated or unstimulated cells and in the presence or absence of other compounds which affect expression patterns.
[0057] Examples of methods of gene expression analysis known in the art include DNA arrays or microarrays (Brazma and Vilo, FEBS Lett ., 2000, 480, 17-24; Celis, et al., FEBS Lett ., 2000, 480, 2-16), SAGE (serial analysis of gene expression)(Madden, et al., Drug Discov. Today , 2000, 5, 415-425), READS (restriction enzyme amplification of digested cDNAs) (Prashar and Weissman, Methods Enzymol ., 1999, 303, 258-72), TOGA (total gene expression analysis) (Sutcliffe, et al., Proc. Natl. Acad. Sci. U. S. A ., 2000, 97, 1976-81), protein arrays and proteomics (Celis, et al., FEBS Lett ., 2000, 480, 2-16; Jungblut, et al., Electrophoresis , 1999, 20, 2100-10), expressed sequence tag (EST) sequencing (Celis, et al., FEBS Lett ., 2000, 480, 2-16; Larsson, et al., J. Biotechnol ., 2000, 80, 143-57), subtractive RNA fingerprinting (SuRF) (Fuchs, et al., Anal. Biochem ., 2000, 286, 91-98; Larson, et al., Cytometry , 2000, 41, 203-208), subtractive cloning, differential display (DD) (Jurecic and Belmont, Curr. Opin. Microbiol ., 2000, 3, 316-21), comparative genomic hybridization (Carulli, et al., J. Cell Biochem. Suppl ., 1998, 31, 286-96), FISH (fluorescent in situ hybridization) techniques (Going and Gusterson, Eur. J. Cancer , 1999, 35, 1895-904) and mass spectrometry methods (To, Comb. Chem. High Throughput Screen , 2000, 3, 235-41).
[0058] The compounds of the invention are useful for research and diagnostics, because these compounds hybridize to nucleic acids encoding tyrosinase. For example, oligonucleotides that are shown to hybridize with such efficiency and under such conditions as disclosed herein as to be effective tyrosinase inhibitors will also be effective primers or probes under conditions favoring gene amplification or detection, respectively. These primers and probes are useful in methods requiring the specific detection of nucleic acid molecules encoding tyrosinase and in the amplification of said nucleic acid molecules for detection or for use in further studies of tyrosinase. Hybridization of the antisense oligonucleotides, particularly the primers and probes, of the invention with a nucleic acid encoding tyrosinase can be detected by means known in the art. Such means may include conjugation of an enzyme to the oligonucleotide, radiolabelling of the oligonucleotide or any other suitable detection means. Kits using such detection means for detecting the level of tyrosinase in a sample may also be prepared.
[0059] The specificity and sensitivity of antisense is also harnessed by those of skill in the art for therapeutic uses. Antisense compounds have been employed as therapeutic moieties in the treatment of disease states in animals, including humans. Antisense oligonucleotide drugs, including ribozymes, have been safely and effectively administered to humans and numerous clinical trials are presently underway. It is thus established that antisense compounds can be useful therapeutic modalities that can be configured to be useful in treatment regimes for the treatment of cells, tissues and animals, especially humans.
[0060] For therapeutics, an animal, preferably a human, suspected of having a disease or disorder which can be treated by modulating the expression of tyrosinase is treated by administering antisense compounds in accordance with this invention. For example, in one non-limiting embodiment, the methods comprise the step of administering to the animal in need of treatment, a therapeutically effective amount of a tyrosinase inhibitor. The tyrosinase inhibitors of the present invention effectively inhibit the activity of the tyrosinase protein or inhibit the expression of the tyrosinase protein. In one embodiment, the activity or expression of tyrosinase in an animal is inhibited by about 10%. Preferably, the activity or expression of tyrosinase in an animal is inhibited by about 30%. More preferably, the activity or expression of tyrosinase in an animal is inhibited by 50% or more.
[0061] For example, the reduction of the expression of tyrosinase may be measured in serum, adipose tissue, liver or any other body fluid, tissue or organ of the animal. Preferably, the cells contained within said fluids, tissues or organs being analyzed contain a nucleic acid molecule encoding tyrosinase protein and/or the tyrosinase protein itself.
[0062] The compounds of the invention can be utilized in pharmaceutical compositions by adding an effective amount of a compound to a suitable pharmaceutically acceptable diluent or carrier. Use of the compounds and methods of the invention may also be useful prophylactically.
F. Modifications
[0063] As is known in the art, a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base. The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to either the 2′, 3′ or 5′ hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn, the respective ends of this linear polymeric compound can be further joined to form a circular compound, however, linear compounds are generally preferred. In addition, linear compounds may have internal nucleobase complementarity and may therefore fold in a manner as to produce a fully or partially double-stranded compound. Within oligonucleotides, the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide. The normal linkage or backbone of RNA and DNA is a 3′ to 5′ phosphodiester linkage.
[0064] Modified Internucleoside Linkages (Backbones)
[0065] Specific examples of preferred antisense compounds useful in this invention include oligonucleotides containing modified backbones or non-natural internucleoside linkages. As defined in this specification, oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.
[0066] Preferred modified oligonucleotide backbones containing a phosphorus atom therein include, for example, phosphorothioates, chiral phosphorothioates, phosphoro-dithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3′-alkylene phosphonates, 5′-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3′-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and borano-phosphates having normal 3′-5′ linkages, 2′-5′ linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3′ to 3′, 5′ to 5′ or 2′ to 2′ linkage. Preferred oligonucleotides having inverted polarity comprise a single 3′ to 3′ linkage at the 3′-most internucleotide linkage i.e. a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof). Various salts, mixed salts and free acid forms are also included.
[0067] Representative United States patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555; 5,527,899; 5,721,218; 5,672,697 and 5,625,050, certain of which are commonly owned with this application, and each of which is herein incorporated by reference.
[0068] Preferred modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; riboacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH 2 component parts.
[0069] Representative United States patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608; 5,646,269 and 5,677,439, certain of which are commonly owned with this application, and each of which is herein incorporated by reference.
[0070] Modified Sugar and Internucleoside Linkages-Mimetics
[0071] In other preferred oligonucleotide mimetics, both the sugar and the internucleoside linkage (i.e. the backbone), of the nucleotide units are replaced with novel groups. The nucleobase units are maintained for hybridization with an appropriate target nucleic acid. One such compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone., Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al., Science , 1991, 254, 1497-1500.
[0072] Preferred embodiments of the invention are oligonucleotides with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular —CH 2 —NH—O—CH 2 —, —CH 2 —N(CH 3 )—O—CH 2 — [known as a methylene (methylimino) or MMI backbone], —CH 2 —O—N(CH 3 )—CH 2 —, —CH 2 —N(CH 3 )—N(CH 3 )—CH 2 and —O —N(CH 3 )—CH 2 —CH 2 — [wherein the native phosphodiester backbone is represented as -O- P- O- CH 2 - ] of the above referenced U.S. Pat. No. 5,489,677, and the amide backbones of the above referenced U.S. Pat. No. 5,602,240. Also preferred are oligonucleotides having morpholino backbone structures of the above-referenced U.S. Pat. No. 5,034,506.
[0073] Modified Sugars
[0074] Modified oligonucleotides may also contain one or more substituted sugar moieties. Preferred oligonucleotides comprise one of the following at the 2′ position: OH; F; O—, S—, or N-alkyl; O—, S—, or N-alkenyl; O—, S—or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C, to C 10 alkyl or C 2 to C 10 alkenyl and alkynyl. Particularly preferred are O[(CH 2 ) n O] m CH 3 , O(CH 2 ) n OCH 3 , O(CH 2 ) n NH 2 , O(CH 2 ) n CH 3 , O(CH 2 ) n ONH 2 , and O(CH 2 n ON[(CH 2 n CH 3 ] 2 , where n and m are from 1 to about 10. Other preferred oligonucleotides comprise one of the following at the 2′ position: C 1 to C 10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 , OCN, Cl, Br, CN, CF 3 , OCF 3 , SOCH 3 , SO 2 CH 3 , ONO 2 , NO 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. A preferred modification includes 2′-methoxyethoxy (2′—O—CH 2 CH 2 OCH 3 , also known as 2′—O—(2-methoxyethyl) or 2′-MOE) (Martin et al., Helv. Chim. Acta , 1995, 78, 486-504) i.e., an alkoxyalkoxy group. A further preferred modification includes 2′-dimethylaminooxyethoxy, i.e., a O(CH 2 ) 2 ON(CH 3 ) 2 group, also known as 2′-DMAOE, as described in examples hereinbelow, and 2′-dimethylaminoethoxyethoxy (also known in the art as 2′—O-dimethyl-amino-ethoxy-ethyl or 2′-DMAEOE), i.e., 2′—O—CH 2 —O—CH 2 —N(CH 3 ) 2 , also described in examples hereinbelow.
[0075] Other preferred modifications include 2′-methoxy (2′—O—CH 3 ), 2′-aminopropoxy (2′—OCH 2 CH 2 CH 2 NH 2 ), 2′-allyl (2′—CH 2 —CH═CH 2 ), 2′—O-allyl (2′—O—CH 2 —CH═CH 2 ) and 2′-fluoro (2 ′-F). The 2′-modification may be in the arabino (up) position or ribo (down) position. A preferred 2′-arabino modification is 2′-F. Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3′ position of the sugar on the 3′ terminal nucleotide or in 2′-5′ linked oligonucleotides and the 5′ position of 5′ terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative United States patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747; and 5,700,920, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.
[0076] A further preferred modification of the sugar includes Locked Nucleic Acids (LNAs) in which the 2′-hydroxyl group is linked to the 3′ or 4′ carbon atom of the sugar ring, thereby forming a bicyclic sugar moiety. The linkage is preferably a methylene (—CH 2 —) n group bridging the 2′ oxygen atom and the 4′ carbon atom wherein n is 1 or 2. LNAs and preparation thereof are described in WO 98/39352 and WO 99/14226.
[0077] Natural and Modified Nucleobases
[0078] Oligonucleotides may also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (—C?C—CH 3 ) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Further modified nucleobases include tricyclic pyrimidines such as phenoxazine cytidine(1H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), phenothiazine cytidine (1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g. 9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H-pyrido[3′, 2′:4,5]pyrrolo[2,3-d]pyrimidin-2-one). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering , pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie , International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y. S., Chapter 15 , Antisense Research and Applications , pages 289-302, Crooke, S. T. and Lebleu, B. ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 ?C and are presently preferred base substitutions, even more particularly when combined with 2′-O-methoxyethyl sugar modifications.
[0079] Representative United States patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos. 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,830,653; 5,763,588; 6,005,096; and 5,681,941, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference, and U.S. Pat. No. 5,750,692, which is commonly owned with the instant application and also herein incorporated by reference.
[0080] Conjugates
[0081] Another modification of the oligonucleotides of the invention involves chemically linking to the oligonucleotide one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide. These moieties or conjugates can include conjugate groups covalently bound to functional groups such as primary or secondary hydroxyl groups. Conjugate groups of the invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Typical conjugate groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic properties, in the context of this invention, include groups that improve uptake, enhance resistance to degradation, and/or strengthen sequence-specific hybridization with the target nucleic acid. Groups that enhance the pharmacokinetic properties, in the context of this invention, include groups that improve uptake, distribution, metabolism or excretion of the compounds of the present invention. Representative conjugate groups are disclosed in International Patent Application PCT/US92/09196, filed Oct. 23, 1992, and U.S. Pat. No. 6,287,860, the entire disclosure of which are incorporated herein by reference. Conjugate moieties include but are not limited to lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl-S-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety. Oligonucleotides of the invention may also be conjugated to active drug substances, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indomethicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic. Oligonucleotide-drug conjugates and their preparation are described in U.S. patent application Ser. No. 09/334,130 (filed Jun. 15, 1999) which is incorporated herein by reference in its entirety.
[0082] Representative United States patents that teach the preparation of such oligonucleotide conjugates include, but are not limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference.
[0083] Chimeric Compounds
[0084] It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single compound or even at a single nucleoside within an oligonucleotide.
[0085] The present invention also includes antisense compounds which are chimeric compounds. “Chimeric” antisense compounds or “chimeras,” in the context of this invention, are antisense compounds, particularly oligonucleotides, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of an oligonucleotide compound. These oligonucleotides typically contain at least one region wherein the oligonucleotide is modified so as to confer upon the oligonucleotide increased resistance to nuclease degradation, increased cellular uptake, increased stability and/or increased binding affinity for the target nucleic acid. An additional region of the oligonucleotide may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNAse H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide-mediated inhibition of gene expression. The cleavage of RNA:RNA hybrids can, in like fashion, be accomplished through the actions of endoribonucleases, such as RNAseL which cleaves both cellular and viral RNA. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.
[0086] Chimeric antisense compounds of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gapmers. Representative United States patents that teach the preparation of such hybrid structures include, but are not limited to, U.S. Pat. Nos. 5,013,830; 5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.
G. Formulations
[0087] The compounds of the invention may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor-targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption. Representative United States patents that teach the preparation of such uptake, distribution and/or absorption-assisting formulations include, but are not limited to, U.S. Pat. Nos. 5,108,921; 5,354,844; 5,416,016; 5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020; 5,591,721; 4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170; 5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854; 5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948; 5,580,575; and 5,595,756, each of which is herein incorporated by reference.
[0088] The antisense compounds of the invention encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the compounds of the invention, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
[0089] The term “prodrug” indicates a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions. In particular, prodrug versions of the oligonucleotides of the invention are prepared as SATE [(S-acetyl-2-thioethyl) phosphate] derivatives according to the methods disclosed in WO 93/24510 to Gosselin et al., published Dec. 9, 1993 or in WO 94/26764 and U.S. Pat. No. 5,770,713 to Imbach et al.
[0090] The term “pharmaceutically acceptable salts” refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. For oligonucleotides, preferred examples of pharmaceutically acceptable salts and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.
[0091] The present invention also includes pharmaceutical compositions and formulations which include the antisense compounds of the invention. The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration. Oligonucleotides with at least one 2′-O-methoxyethyl modification are believed to be particularly useful for oral administration. Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful.
[0092] The pharmaceutical formulations of the present invention, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
[0093] The compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.
[0094] Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, foams and liposome-containing formulations. The pharmaceutical compositions and formulations of the present invention may comprise one or more penetration enhancers, carriers, excipients or other active or inactive ingredients.
[0095] Emulsions are typically heterogenous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 ?m in diameter. Emulsions may contain additional components in addition to the dispersed phases, and the active drug which may be present as a solution in either the aqueous phase, oily phase or itself as a separate phase. Microemulsions are included as an embodiment of the present invention. Emulsions and their uses are well known in the art and are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.
[0096] Formulations of the present invention include liposomal formulations. As used in the present invention, the term “liposome” means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers. Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior that contains the composition to be delivered. Cationic liposomes are positively charged liposomes which are believed to interact with negatively charged DNA molecules to form a stable complex. Liposomes that are pH-sensitive or negatively-charged are believed to entrap DNA rather than complex with it. Both cationic and noncationic liposomes have been used to deliver DNA to cells.
[0097] Liposomes also include “sterically stabilized” liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome comprises one or more glycolipids or is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. Liposomes and their uses are further described in U.S. Patent 6,287,860, which is incorporated herein in its entirety.
[0098] The pharmaceutical formulations and compositions of the present invention may also include surfactants. The use of surfactants in drug products, formulations and in emulsions is well known in the art. Surfactants and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.
[0099] In one embodiment, the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly oligonucleotides. In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs. Penetration enhancers may be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants. Penetration enhancers and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.
[0100] One of skill in the art will recognize that formulations are routinely designed according to their intended use, i.e. route of administration.
[0101] Preferred formulations for topical administration include those in which the oligonucleotides of the invention are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Preferred lipids and liposomes include neutral (e.g. dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g. dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g. dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA).
[0102] For topical or other administration, oligonucleotides of the invention may be encapsulated within liposomes or may BIOLOO05US -39- PATENT form complexes thereto, in particular to cationic liposomes. Alternatively, oligonucleotides may be complexed to lipids, in particular to cationic lipids. Preferred fatty acids and esters, pharmaceutically acceptable salts thereof, and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety. Topical formulations are described in detail in United States patent application 09/315,298 filed on May 20, 1999, which is incorporated herein by reference in its entirety.
[0103] Compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable. Preferred oral formulations are those in which oligonucleotides of the invention are administered in conjunction with one or more penetration enhancers surfactants and chelators. Preferred surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof. Preferred bile acids/salts and fatty acids and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety. Also preferred are combinations of penetration enhancers, for example, fatty acids/salts in combination with bile acids/salts. A particularly preferred combination is the sodium salt of lauric acid, capric acid and UDCA. Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. Oligonucleotides of the invention may be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or nanoparticles. Oligonucleotide complexing agents and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety. Oral formulations for oligonucleotides and their preparation are described in detail in United States applications 09/108,673 (filed Jul. 1, 1998), 09/315,298 (filed May 20, 1999) and 10/071,822, filed Feb. 8, 2002, each of which is incorporated herein by reference in their entirety.
[0104] Compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
[0105] Certain embodiments of the invention provide pharmaceutical compositions containing one or more oligomeric compounds and one or more other chemotherapeutic agents which function by a non-antisense mechanism. Examples of such chemotherapeutic agents include but are not limited to cancer chemotherapeutic drugs such as daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin, bleomycin, mafosfamide, ifosfamide, cytosine arabinoside, bis-chloroethylnitrosurea, busulfan, mitomycin C, actinomycin D, mithramycin, prednisone, hydroxyprogesterone, testosterone, tamoxifen, dacarbazine, procarbazine, hexamethylmelamine, pentamethylmelamine, mitoxantrone, amsacrine, chlorambucil, methylcyclohexylnitrosurea, nitrogen mustards, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-azacytidine, hydroxyurea, deoxyco-formycin, 4-hydroxyperoxycyclophosphoramide, 5-fluorouracil (5-FU), 5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX), colchicine, taxol, vincristine, vinblastine, etoposide (VP-16), trimetrexate, irinotecan, topotecan, gemcitabine, teniposide, cisplatin and diethylstilbestrol (DES). When used with the compounds of the invention, such chemotherapeutic agents may be used individually (e.g., 5-FU and oligonucleotide), sequentially (e.g., 5-FU and oligonucleotide for a period of time followed by MTX and oligonucleotide), or in combination with one or more other such chemotherapeutic agents (e.g., 5-FU, MTX and oligonucleotide, or 5-FU, radiotherapy and oligonucleotide). Anti-inflammatory drugs, including but not limited to nonsteroidal anti-inflammatory drugs and corticosteroids, and antiviral drugs, including but not limited to ribivirin, vidarabine, acyclovir and ganciclovir, may also be combined in compositions of the invention. Combinations of antisense compounds and other non-antisense drugs are also within the scope of this invention. Two or more combined compounds may be used together or sequentially.
[0106] In another related embodiment, compositions of the invention may contain one or more antisense compounds, particularly oligonucleotides, targeted to a first nucleic acid and one or more additional antisense compounds targeted to a second nucleic acid target. Alternatively, compositions of the invention may contain two or more antisense compounds targeted to different regions of the same nucleic acid target. Numerous examples of antisense compounds are known in the art. Two or more combined compounds may be used together or sequentially.
H. Dosing
[0107] The formulation of therapeutic compositions and their subsequent administration (dosing) is believed to be within the skill of those in the art. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC 50 s found to be effective in in vitro and in vivo animal models. In general, dosage is from 0.01 ug to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations of the drug in bodily fluids or tissues. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the oligonucleotide is administered in maintenance doses, ranging from 0.01 ug to 100 g per kg of body weight, once or more daily, to once every 20 years.
[0108] While the present invention has been described with specificity in accordance with certain of its preferred embodiments, the following examples serve only to illustrate the invention and are not intended to limit the same.
EXAMPLES
Example 1
Synthesis of Nucleoside Phosphoramidites
[0109] The following compounds, including amidites and their intermediates were prepared as described in U.S. Pat. No. 6,426,220 and published PCT WO 02/36743; 5′-O-Dimethoxytrityl-thymidine intermediate for 5-methyl dC amidite, 5′-O-Dimethoxytrityl-2′-deoxy-5-methylcytidine intermediate for 5-methyl-dC amidite, 5′-O-Dimethoxytrityl-2′-deoxy-N4-benzoyl-5-methylcytidine penultimate intermediate for 5-methyl dC amidite, [5′-O-(4,4′-Dimethoxytriphenylmethyl)-2′-deoxy-N 4 -benzoyl-5-methylcytidin-3′-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite (5-methyl dC amidite), 2′-Fluorodeoxyadenosine, 2′-Fluorodeoxyguanosine, 2′-Fluorouridine, 2′-Fluorodeoxycytidine, 2′-O-(2-Methoxyethyl) modified amidites, 2′-O-(2-methoxyethyl)-5-methyluridine intermediate, 5′-O-DMT-2′-O-(2-methoxyethyl)-5-methyluridine penultimate intermediate, [5′-O-(4,4′-Dimethoxytriphenylmethyl)-2′-O-(2-methoxyethyl)-5-methyluridin-3′-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite (MOE T amidite), 5′-O-Dimethoxytrityl-2′-O-(2-methoxyethyl)-5-methylcytidine intermediate, 5′-O-dimethoxytrityl-2′-O-(2-methoxyethyl)-N 4 -benzoyl-5-methyl-cytidine penultimate intermediate, [5′-O-(4,4′-Dimethoxytriphenylmethyl)-2′-O-(2-methoxyethyl)-N -benzoyl-5-methylcytidin-3′-O-yl]-2-cyanoethyl-N,AN-diisopropylphosphoramidite (MOE 5-Me-C amidite), [5′-O-(4,4′-Dimethoxytriphenylmethyl)-2′-O-(2-methoxyethyl)-N 6 -benzoyladenosin-31-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite (MOE A amdite), [5′-O-(4,4′-Dimethoxytriphenylmethyl)-2′-O-(2-methoxyethyl)-N -isobutyrylguanosin-3′-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite (MOE G amidite), 2′-O-(Aminooxyethyl) nucleoside amidites and 2′-O-(dimethylamino-oxyethyl) nucleoside amidites, 2′-(Dimethylaminooxyethoxy) nucleoside amidites, 5′-O-tert-Butyldiphenylsilyl-0 2 -2′-anhydro-5-methyluridine, 5′-O-tert-Butyldiphenylsilyl-2′-O-(2-hydroxyethyl)-5-methyluridine, 2′-O-([2-phthalimidoxy)ethyl]-5′-t-butyldiphenylsilyl-5-methyluridine, 5′-O-tert-butyldiphenylsilyl-2′-O-[(2-formadoximinooxy)ethyl]-5-methyluridine, 51-O-tert-Butyldiphenylsilyl-2′-O-[N,N dimethylaminooxyethyl]-5-methyluridine, 2′-O-(dimethylaminooxyethyl)-5-methyluridine, 5′-O-DMT-2′-O-(dimethylaminooxyethyl)-5-methyluridine, 5′-O-DMT-2′-O-(2-N,N-dimethylaminooxyethyl)-5-methyluridine-3′-[(2-cyanoethyl)-N,N-diisopropylphosphoramidite], 2′-(Aminooxyethoxy) nucleoside amidites, N2-isobutyryl-6-O-diphenylcarbamoyl-2′-O-(2-ethylacetyl)-5′-O-(4,4′-dimethoxytrityl)guanosine-31-[(2-cyanoethyl)-N,N-diisopropylphosphoramidite], 2′-dimethylaminoethoxyethoxy (2′-DMAEOE) nucleoside amidites, 2 1 -O-[2(2-N,N-dimethylaminoethoxy)ethyl]-5-methyl uridine, 5′-O-dimethoxytrityl-2′-O-[2(2-N,N-dimethylaminoethoxy)-ethyl)]-5-methyl uridine and 51-O-Dimethoxytrityl-2′-O-[2(2-N,N-dimethylaminoethoxy)-ethyl)]-5-methyl uridine-3′-O-(cyanoethyl-N,N-diisopropyl)phosphoramidite.
Example 2
Oligonucleotide and Oligonucleoside Synthesis
[0110] The antisense compounds used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives.
[0111] Oligonucleotides: Unsubstituted and substituted phosphodiester (P═O) oligonucleotides are synthesized on an automated DNA synthesizer (Applied Biosystems model 394) using standard phosphoramidite chemistry with oxidation by iodine.
[0112] Phosphorothioates (P═S) are synthesized similar to phosphodiester oligonucleotides with the following exceptions: thiation was effected by utilizing a 10% w/v solution of 3,H-1,2-benzodithiole-3-one 1,1-dioxide in acetonitrile for the oxidation of the phosphite linkages. The thiation reaction step time was increased to 180 sec and preceded by the normal capping step. After cleavage from the CPG column and deblocking in concentrated ammonium hydroxide at 55?C (12-16 hr), the oligonucleotides were recovered by precipitating with >3 volumes of ethanol from a 1 M NH 4 OAc solution. Phosphinate oligonucleotides are prepared as described in U.S. Pat. No. 5,508,270, herein incorporated by reference.
[0113] Alkyl phosphonate oligonucleotides are prepared as described in U.S. Pat. No. 4,469,863, herein incorporated by reference.
[0114] 3′-Deoxy-3′-methylene phosphonate oligonucleotides are prepared as described in U.S. Pat. Nos. 5,610,289 or 5,625,050, herein incorporated by reference.
[0115] Phosphoramidite oligonucleotides are prepared as described in U.S. Pat. No., 5,256,775 or U.S. Pat. No. 5,366,878, herein incorporated by reference.
[0116] Alkylphosphonothioate oligonucleotides are prepared as described in published PCT applications PCT/US94/00902 and PCT/US93/06976 (published as WO 94/17093 and WO 94/02499, respectively), herein incorporated by reference.
[0117] 3′-Deoxy-3′-amino phosphoramidate oligonucleotides are prepared as described in U.S. Pat. No. 5,476,925, herein incorporated by reference.
[0118] Phosphotriester oligonucleotides are prepared as described in U.S. Pat. No. 5,023,243, herein incorporated by reference.
[0119] Borano phosphate oligonucleotides are prepared as described in U.S. Pat. Nos. 5,130,302 and 5,177,198, both herein incorporated by reference.
[0120] Oligonucleosides: Methylenemethylimino linked oligonucleosides, also identified as MMI linked oligonucleosides, methylenedimethylhydrazo linked oligonucleosides, also identified as MDH linked oligonucleosides, and methylenecarbonylamino linked oligonucleosides, also identified as amide-3 linked oligonucleosides, and methyleneaminocarbonyl linked oligo-nucleosides, also identified as amide-4 linked oligonucleo-sides, as well as mixed backbone compounds having, for instance, alternating MMI and P═O or P═S linkages are prepared as described in U.S. Pat. Nos. 5,378,825, 5,386,023, 5,489,677, 5,602,240 and 5,610,289, all of which are herein incorporated by reference.
[0121] Formacetal and thioformacetal linked oligonucleosides are prepared as described in U.S. Pat. Nos. 5,264,562 and 5,264,564, herein incorporated by reference.
[0122] Ethylene oxide linked oligonucleosides are prepared as described in U.S. Pat. No. 5,223,618, herein incorporated by reference.
Example 3
RNA Synthesis
[0123] In general, RNA synthesis chemistry is based on the selective incorporation of various protecting groups at strategic intermediary reactions. Although one of ordinary skill in the art will understand the use of protecting groups in organic synthesis, a useful class of protecting groups includes silyl ethers. In particular bulky silyl ethers are used to protect the 5′-hydroxyl in combination with an acid-labile orthoester protecting group on the 2′-hydroxyl. This set of protecting groups is then used with standard solid-phase synthesis technology. It is important to lastly remove the acid labile orthoester protecting group after all other synthetic steps. Moreover, the early use of the silyl protecting groups during synthesis ensures facile removal when desired, without undesired deprotection of 2′ hydroxyl.
[0124] Following this procedure for the sequential protection of the 5′-hydroxyl in combination with protection of the 2′-hydroxyl by protecting groups that are differentially removed and are differentially chemically labile, RNA oligonucleotides were synthesized.
[0125] RNA oligonucleotides are synthesized in a stepwise fashion. Each nucleotide is added sequentially (3′- to 5′-direction) to a solid support-bound oligonucleotide. The first nucleoside at the 3′-end of the chain is covalently attached to a solid support. The nucleotide precursor, a ribonucleoside phosphoramidite, and activator are added, coupling the second base onto the 5′-end of the first nucleoside. The support is washed and any unreacted 5′-hydroxyl groups are capped with acetic anhydride to yield 5′-acetyl moieties. The linkage is then oxidized to the more stable and ultimately desired P(V) linkage. At the end of the nucleotide addition cycle, the 5′-silyl group is cleaved with fluoride. The cycle is repeated for each subsequent nucleotide.
[0126] Following synthesis, the methyl protecting groups on the phosphates are cleaved in 30 minutes utilizing 1 M disodium-2-carbamoyl-2-cyanoethylene-l,1-dithiolate trihydrate (S 2 Na 2 ) in DMF. The deprotection solution is washed from the solid support-bound oligonucleotide using water. The support is then treated with 40% methylamine in water for 10 minutes at 55° C. This releases the RNA oligonucleotides into solution, deprotects the exocyclic amines, and modifies the 2′- groups. The oligonucleotides can be analyzed by anion exchange HPLC at this stage.
[0127] The 2′-orthoester groups are the last protecting groups to be removed. The ethylene glycol monoacetate orthoester protecting group developed by Dharmacon Research, Inc. (Lafayette, CO), is one example of a useful orthoester protecting group which, has the following important properties. It is stable to the conditions of nucleoside phosphoramidite synthesis and oligonucleotide synthesis. However, after oligonucleotide synthesis the oligonucleotide is treated with methylamine which not only cleaves the oligonucleotide from the solid support but also removes the acetyl groups from the orthoesters. The resulting 2-ethyl-hydroxyl substituents on the orthoester are less electron withdrawing than the acetylated precursor. As a result, the modified orthoester becomes more labile to acid-catalyzed hydrolysis. Specifically, the rate of cleavage is approximately 10 times faster after the acetyl groups are removed. Therefore, this orthoester possesses sufficient stability in order to be compatible with oligonucleotide synthesis and yet, when subsequently modified, permits deprotection to be carried out under relatively mild aqueous conditions compatible with the final RNA oligonucleotide product.
[0128] Additionally, methods of RNA synthesis are well known in the art (Scaringe, S. A. Ph.D. Thesis, University of Colorado, 1996; Scaringe, S. A., et al., J. Am. Chem. Soc ., 1998, 120, 11820-11821; Matteucci, M. D. and Caruthers, M. H. J. Am. Chem. Soc ., 1981, 103, 3185-3191; Beaucage, S. L. and Caruthers, M. H. Tetrahedron Lett ., 1981, 22, 1859-1862; Dahl, B. J., et al., Acta Chem. Scand ,. 1990, 44, 639-641; Reddy, M. P., et al., Tetrahedrom Lett ., 1994, 25, 4311-4314; Wincott, F. et al., Nucleic Acids Res ., 1995, 23, 2677-2684; Griffin, B. E., et al., Tetrahedron , 1967, 23, 2301-2313; Griffin, B. E., et al., Tetrahedron , 1967, 23, 2315-2331).
[0129] RNA antisense compounds (RNA oligonucleotides) of the present invention can be synthesized by the methods herein or purchased from Dharmacon Research, Inc (Lafayette, Colo.). Once synthesized, complementary RNA antisense compounds can then be annealed by methods known in the art to form double stranded (duplexed) antisense compounds. For example, duplexes can be formed by combining 30 μl of each of the complementary strands of RNA oligonucleotides (50 uM RNA oligonucleotide solution) and 15 μl of 5× annealing buffer (100 mM potassium acetate, 30 mM HEPES-KOH pH 7.4, 2 mM magnesium acetate) followed by heating for 1 minute at 90° C., then 1 hour at 37° C. The resulting duplexed antisense compounds can be used in kits, assays, screens, or other methods to investigate the role of a target nucleic acid.
Example 4
Synthesis of Chimeric Oligonucleotides
[0130] Chimeric oligonucleotides, oligonucleosides or mixed oligonucleotides/oligonucleosides of the invention can be of several different types. These include a first type wherein the “gap” segment of linked nucleosides is positioned between 5′ and 3′ “wing” segments of linked nucleosides and a second “open end” type wherein the “gap” segment is located at either the 3′ or the 5′ terminus of the oligomeric compound. oligonucleotides of the first type are also known in the art as “gapmers” or gapped oligonucleotides. Oligonucleotides of the second type are also known in the art as “hemimers” or “wingmers”.
[0131] [2′-O-Me]-[2′-deoxy]-[2′-O-Me] Chimeric Phosphorothioate Oligonucleotides
[0132] Chimeric oligonucleotides having 2′-O-alkyl phosphorothioate and 2′-deoxy phosphorothioate oligo-nucleotide segments are synthesized using an Applied Biosystems automated DNA synthesizer Model 394, as above. Oligonucleotides are synthesized using the automated synthesizer and 2′-deoxy-5′-dimethoxytrityl-31-O-phosphor-amidite for the DNA portion and 5′-dimethoxytrityl-2′-O-methyl-3′-O-phosphoramidite for 5′ and 3′ wings. The standard synthesis cycle is modified by incorporating coupling steps with increased reaction times for the 5′-dimethoxytrityl-2′-O-methyl-3′-O-phosphoramidite. The fully protected oligonucleotide is cleaved from the support and deprotected in concentrated ammonia (NH 40 H) for 12-16 hr at 55° C. The deprotected oligo is then recovered by an appropriate method (precipitation, column chromatography, volume reduced in vacuo and analyzed spetrophotometrically for yield and for purity by capillary electrophoresis and by mass spectrometry.
[0133] [2′-O-(2-Methoxyethyl)]-[2′-deoxy]-[2′-O-(Methoxyethyl)] Chimeric Phosphorothioate Oligonucleotides
[0134] [2′-O-(2-methoxyethyl)]-[2′-deoxy]-[-2′-O-(methoxyethyl)] chimeric phosphorothioate oligonucleotides were prepared as per the procedure above for the 2′-O-methyl chimeric oligonucleotide, with the substitution of 2′-O-(methoxyethyl) amidites for the 2′-O-methyl amidites.
[0135] [2′-O-(2-Methoxyethyl)Phosphodiester]-[2′-deoxy Phosphorothioate]-[2′-O-(2-Methoxyethyl) Phosphodiester] Chimeric Oligonucleotides
[0136] [2′-O-(2-methoxyethyl phosphodiester]-[2′-deoxy phosphorothioate]-[2′-O-(methoxyethyl) phosphodiester] chimeric oligonucleotides are prepared as per the above procedure for the 2′-O-methyl chimeric oligonucleotide with the substitution of 2′-O-(methoxyethyl) amidites for the 2′-O-methyl amidites, oxidation with iodine to generate the phosphodiester internucleotide linkages within the wing portions of the chimeric structures and sulfurization utilizing 3,H-1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) to generate the phosphorothioate internucleotide linkages for the center gap.
[0137] Other chimeric oligonucleotides, chimeric oligonucleosides and mixed chimeric oligonucleotides/oligonucleosides are synthesized according to U.S. Pat. No. 5,623,065, herein incorporated by reference.
Example 5
Design and Screening of Duplexed Antisense Compounds Targeting Tyrosinase
[0138] In accordance with the present invention, a series of nucleic acid duplexes comprising the antisense compounds of the present invention and their complements can be designed to target tyrosinase. The nucleobase sequence of the antisense strand of the duplex comprises at least a portion of an oligonucleotide in Table 1. The ends of the strands may be modified by the addition of one or more natural or modified nucleobases to form an overhang. The sense strand of the dsRNA is then designed and synthesized as the complement of the antisense strand and may also contain modifications or additions to either terminus. For example, in one embodiment, both strands of the dsRNA duplex would be complementary over the central nucleobases, each having overhangs at one or both termini.
[0139] For example, a duplex comprising an antisense strand having the sequence CGAGAGGCGGACGGGACCG and having a two-nucleobase overhang of deoxythymidine(dT) would have the following structure:
cgagaggcggacgggaccgTT Antisense Strand ||||||||||||||||||| TTgctctccgcctgccctggc Complement
[0140] RNA strands of the duplex can be synthesized by methods disclosed herein or purchased from Dharmacon Research Inc., (Lafayette, Colo.). Once synthesized, the complementary strands are annealed. The single strands are aliquoted and diluted to a concentration of 50 um. Once diluted, 30 uL of each strand is combined with 15 uL of a 5× solution of annealing buffer. The final concentration of said buffer is 100 mM potassium acetate, 30 mM HEPES-KOH pH 7.4, and 2 mM magnesium acetate. The final volume is 75 uL. This solution is incubated for 1 minute at 90° C. and then centrifuged for 15 seconds. The tube is allowed to sit for 1 hour at 37° C. at which time the dsRNA duplexes are used in experimentation. The final concentration of the dsRNA duplex is 20 uM. This solution can be stored frozen (−20° C.) and freeze-thawed up to 5 times.
[0141] Once prepared, the duplexed antisense compounds are evaluated for their ability to modulate tyrosinase expression.
[0142] When cells reached 80% confluency, they are treated with duplexed antisense compounds of the invention. For cells grown in 96-well plates, wells are washed once with 200 μL OPTI-MEM-1 reduced-serum medium (Gibco BRL) and then treated with 130 μL of OPTI-MEM-1 containing 12 μg/mL LIPOFECTIN (Gibco BRL) and the desired duplex antisense compound at a final concentration of 200 nM. After 5 hours of treatment, the medium is replaced with fresh medium. Cells are harvested 16 hours after treatment, at which time RNA is isolated and target reduction measured by RT-PCR.
Example 6
Oligonucleotide Isolation
[0143] After cleavage from the controlled pore glass solid support and deblocking in concentrated ammonium hydroxide at 55?C for 12-16 hours, the oligonucleotides or oligonucleosides are recovered by precipitation out of 1 M NH 4 OAc with >3 volumes of ethanol. Synthesized oligonucleotides were analyzed by electrospray mass spectroscopy (molecular weight determination) and by capillary gel electrophoresis and judged to be at least 70% full length material. The relative amounts of phosphorothioate and phosphodiester linkages obtained in the synthesis was determined by the ratio of correct molecular weight relative to the −16 amu product (+/−32 +/−48). For some studies oligonucleotides were purified by HPLC, as described by Chiang et al., J. Biol. Chem . 1991, 266, 18162-18171. Results obtained with HPLC-purified material were similar to those obtained with non-HPLC purified material.
Example 7
Oligonucleotide Synthesis-96 Well Plate Format
[0144] Oligonucleotides were synthesized via solid phase P(III) phosphoramidite chemistry on an automated synthesizer capable of assembling 96 sequences simultaneously in a 96-well format. Phosphodiester internucleotide linkages were afforded by oxidation with aqueous iodine. Phosphorothioate internucleotide linkages were generated by sulfurization utilizing 3, H-1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) in anhydrous acetonitrile. Standard base-protected beta-cyanoethyl-diiso-propyl phosphoramidites were purchased from commercial vendors (e.g. PE-Applied Biosystems, Foster City, Calif., or Pharmacia, Piscataway, N.J.). Non-standard nucleosides are synthesized as per standard or patented methods. They are utilized as base protected beta-cyanoethyldiisopropyl phosphoramidites.
[0145] Oligonucleotides were cleaved from support and deprotected with concentrated NH 4 OH at elevated temperature (55-60° C.) for 12-16 hours and the released product then dried in vacuo. The dried product was then re-suspended in sterile water to afford a master plate from which all analytical and test plate samples are then diluted utilizing robotic pipettors.
Example 8
Oligonucleotide Analysis -96-Well Plate Format
[0146] The concentration of oligonucleotide in each well was assessed by dilution of samples and UV absorption spectroscopy. The full-length integrity of the individual products was evaluated by capillary electrophoresis (CE) in either the 96-well format (Beckman P/ACE? MDQ) or, for individually prepared samples, on a commercial CE apparatus (e.g., Beckman P/ACE? 5000, ABI 270). Base and backbone composition was confirmed by mass analysis of the compounds utilizing electrospray-mass spectroscopy. All assay test plates were diluted from the master plate using single and multi-channel robotic pipettors. Plates were judged to be acceptable if at least 85% of the compounds on the plate were at least 85% full length.
Example 9
Cell Culture and Oligonucleotide Treatment
[0147] The effect of antisense compounds on target nucleic acid expression can be tested in any of a variety of cell types provided that the target nucleic acid is present at measurable levels. This can be routinely determined using, for example, PCR or Northern blot analysis. The following cell types are provided for illustrative purposes, but other cell types can be routinely used, provided that the target is expressed in the cell type chosen. This can be readily determined by methods routine in the art, for example Northern blot analysis, ribonuclease protection assays, or RT-PCR.
[0148] T-24 Cells:
[0149] The human transitional cell bladder carcinoma cell line T-24 was obtained from the American Type Culture Collection (ATCC) (Manassas, Va.). T-24 cells were routinely cultured in complete McCoy's 5A basal media (Invitrogen Corporation, Carlsbad, Calif.) supplemented with 10% fetal calf serum (Invitrogen Corporation, Carlsbad, Calif.), penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Invitrogen Corporation, Carlsbad, Calif.). Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells were seeded into 96-well plates (Falcon-Primaria #353872) at a density of 7000 cells/well for use in RT-PCR analysis.
[0150] For Northern blotting or other analysis, cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide.
[0151] A549 Cells:
[0152] The human lung carcinoma cell line A549 was obtained from the American Type Culture Collection (ATCC) (Manassas, Va.). A549 cells were routinely cultured in DMEM basal media (Invitrogen Corporation, Carlsbad, Calif.) supplemented with 10% fetal calf serum (Invitrogen Corporation, Carlsbad, Calif.), penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Invitrogen Corporation, Carlsbad, Calif.). Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence.
[0153] NHDF Cells:
[0154] Human neonatal dermal fibroblast (NHDF) were obtained from the Clonetics Corporation (Walkersville, Md.). NHDFs were routinely maintained in Fibroblast Growth Medium (Clonetics Corporation, Walkersville, Md.) supplemented as recommended by the supplier. Cells were maintained for up to 10 passages as recommended by the supplier.
[0155] HEK Cells:
[0156] Human embryonic keratinocytes (HEK) were obtained from the Clonetics Corporation (Walkersville, Md.). HEKs were routinely maintained in Keratinocyte Growth Medium (Clonetics Corporation, Walkersville, Md.) formulated as recommended by the supplier. Cells were routinely maintained for up to 10 passages as recommended by the supplier.
[0157] G-361 Cells:
[0158] The human malignant melanoma cell line G-361 were obtained from the American Type Culture Collection (ATCC) (Manassas, Va.). G-361 cells were routinely maintained in RPMI1640, 10% FBS Growth Medium (Gibco, Grand Island, N.Y.) formulated as recommended by the supplier.
[0159] G-361 cells were electroporated under the following conditions. The cells are washed once in cold Opti-MEM/10% FBS, resuspended at 1×10 6 /mL and 0.4 mL, and aliquoted into a 2 mm gap cuvette. This cell suspension is treated with 5 uM antisense oligonucleotide. 175 V is applied to the cuvette for 9 msec and the cells are allowed to rest for 15 minutes. Then the cells are transferred to 1 mL of warm growth media (RPMI, 10% FBS). After incubation overnight at 5% CO 2 , 37° C., the non-adherent cells are removed by aspiration and the adherent cells are lysed in 350 ul of RLT buffer (Qiagen, Valencia, Calif.). RNA was purified on RNeasy columns (Qiagen, Valencia, Calif.) and used in the standard RT-PCR assay.
[0160] B16-F10 Cells:
[0161] The murine melanoma cell line B16-F10 were obtained from the American Type Culture Collection (ATCC) (Manassas, Va.). B16-F10 cells were routinely maintained in Dulbecco Modified Eagle's Medium with 4 mM L-glutamine, 4.5 g/L glucose, 1.5 g/L sodium bicarbonate, and 10% fetal bovine serum. Cells were routinely maintained for up to 20 passages as recommended by the supplier.
[0162] Treatment with Antisense Compounds:
[0163] When cells reached 65-75% confluency, they were treated with oligonucleotide. For cells grown in 96-well plates, wells were washed once with 100 ?L OPTI-MEM?-1 reduced-serum medium (Invitrogen Corporation, Carlsbad, Calif.) and then treated with 130 ?L of OPTI-MEM?-1 containing 3.75 ?g/mL LIPOFECTIN? (Invitrogen Corporation, Carlsbad, Calif.) and the desired concentration of oligonucleotide. Cells are treated and data are obtained in triplicate. After 4-7 hours of treatment at 37° C., the medium was replaced with fresh medium. Cells were harvested 16-24 hours after oligonucleotide treatment.
[0164] The concentration of oligonucleotide used varies from cell line to cell line. To determine the optimal oligonucleotide concentration for a particular cell line, the cells are treated with a positive control oligonucleotide at a range of concentrations. For human cells the positive control oligonucleotide is selected from either ISIS 13920 (TCCGTCATCGCTCCTCAGGG, SEQ ID NO: 1) which is targeted to human H-ras, or ISIS 18078, (GTGCGCGCGAGCCCGAAATC, SEQ ID NO: 2) which is targeted to human Jun-N-terminal kinase-2 (JNK2). Both controls are 2′-O-methoxyethyl gapmers (2′-O-methoxyethyls shown in bold) with a phosphorothioate backbone. For mouse or rat cells the positive control oligonucleotide is ISIS 15770, ATGCATTCTGCCCCCAAGGA, SEQ ID NO: 3, a 2′-O-methoxyethyl gapmer (2′-O-methoxyethyls shown in bold) with a phosphorothioate backbone which is targeted to both mouse and rat c-raf. The concentration of positive control oligonucleotide that results in 80% inhibition of c-H-ras (for ISIS 13920), JNK2 (for ISIS 18078) or c-raf (for ISIS 15770) mRNA is then utilized as the screening concentration for new oligonucleotides in subsequent experiments for that cell line. If 80% inhibition is not achieved, the lowest concentration of positive control oligonucleotide that results in 60% inhibition of c-H-ras, JNK2 or c-raf mRNA is then utilized as the oligonucleotide screening concentration in subsequent experiments for that cell line. If 60% inhibition is not achieved, that particular cell line is deemed as unsuitable for oligonucleotide transfection experiments. The concentrations of antisense oligonucleotides used herein are from 50 nM to 300 nM.
Example 10
Analysis of oligonucleotide inhibition of tyrosinase expression
[0165] Antisense modulation of tyrosinase expression can be assayed in a variety of ways known in the art. For example, tyrosinase mRNA levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or real-time PCR (RT-PCR). Real-time quantitative PCR is presently preferred. RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. The preferred method of RNA analysis of the present invention is the use of total cellular RNA as described in other examples herein. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Real-time quantitative (PCR) can be conveniently accomplished using the commercially available ABI PRISM? 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, Calif. and used according to manufacturer's instructions.
[0166] Protein levels of tyrosinase can be quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA) or fluorescence-activated cell sorting (FACS). Antibodies directed to tyrosinase can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art.
Example 11
Design of phenotypic assays and in vivo studies for the use of tyrosinase inhibitors
[0167] Phenotypic Assays
[0168] Once tyrosinase inhibitors have been identified by the methods disclosed herein, the compounds are further investigated in one or more phenotypic assays, each having measurable endpoints predictive of efficacy in the treatment of a particular disease state or condition. Phenotypic assays, kits and reagents for their use are well known to those skilled in the art and are herein used to investigate the role and/or association of tyrosinase in health and disease. Representative phenotypic assays, which can be purchased from any one of several commercial vendors, include those for determining cell viability, cytotoxicity, proliferation or cell survival (Molecular Probes, Eugene, Oreg.; PerkinElmer, Boston, Mass.), protein-based assays including enzymatic assays (Panvera, LLC, Madison, Wis.; BD Biosciences, Franklin Lakes, N.J.; Oncogene Research Products, San Diego, Calif.), cell regulation, signal transduction, inflammation, oxidative processes and apoptosis (Assay Designs Inc., Ann Arbor, Mich.), triglyceride accumulation (Sigma-Aldrich, St. Louis, Mo.), angiogenesis assays, tube formation assays, cytokine and hormone assays and metabolic assays (Chemicon International Inc., Temecula, Calif.; Amersham Biosciences, Piscataway, N.J.).
[0169] In one non-limiting example, cells determined to be appropriate for a particular phenotypic assay (i.e., MCF-7 cells selected for breast cancer studies; adipocytes for obesity studies) are treated with tyrosinase inhibitors identified from the in vitro studies as well as control compounds at optimal concentrations which are determined by the methods described above. At the end of the treatment period, treated and untreated cells are analyzed by one or more methods specific for the assay to determine phenotypic outcomes and endpoints.
[0170] Phenotypic endpoints include changes in cell morphology over time or treatment dose as well as changes in levels of cellular components such as proteins, lipids, nucleic acids, hormones, saccharides or metals. Measurements of cellular status which include pH, stage of the cell cycle, intake or excretion of biological indicators by the cell, are also endpoints of interest.
[0171] Analysis of the geneotype of the cell (measurement of the expression of one or more of the genes of the cell) after treatment is also used as an indicator of the efficacy or potency of the tyrosinase inhibitors. Hallmark genes, or those genes suspected to be associated with a specific disease state, condition, or phenotype, are measured in both treated and untreated cells.
[0172] In vivo Studies
[0173] The individual subjects of the in vivo studies described herein are warm-blooded vertebrate animals, which includes humans.
[0174] The clinical trial is subjected to rigorous controls to ensure that individuals are not unnecessarily put at risk and that they are fully informed about their role in the study. To account for the psychological effects of receiving treatments, volunteers are randomly given placebo or tyrosinase inhibitor. Furthermore, to prevent the doctors from being biased in treatments, they are not informed as to whether the medication they are administering is a tyrosinase inhibitor or a placebo. Using this randomization approach, each volunteer has the same chance of being given either the new treatment or the placebo.
[0175] Volunteers receive either the tyrosinase inhibitor or placebo for eight week period with biological parameters associated with the indicated disease state or condition being measured at the beginning (baseline measurements before any treatment), end (after the final treatment), and at regular intervals during the study period. Such measurements include the levels of nucleic acid molecules encoding tyrosinase or tyrosinase protein levels in body fluids, tissues or organs compared to pre-treatment levels. Other measurements include, but are not limited to, indices of the disease state or condition being treated, body weight, blood pressure, serum titers of pharmacologic indicators of disease or toxicity as well as ADME (absorption, distribution, metabolism and excretion) measurements.
[0176] Information recorded for each patient includes age (years), gender, height (cm), family history of disease state or condition (yes/no), motivation rating (some/moderate/great) and number and type of previous treatment regimens for the indicated disease or condition.
[0177] Volunteers taking part in this study are healthy adults (age 18 to 65 years) and roughly an equal number of males and females participate in the study. Volunteers with certain characteristics are equally distributed for placebo and tyrosinase inhibitor treatment. In general, the volunteers treated with placebo have little or no response to treatment, whereas the volunteers treated with the tyrosinase inhibitor show positive trends in their disease state or condition index at the conclusion of the study.
Example 12
RNA Isolation
[0178] Poly(A)+ MRNA Isolation
[0179] Poly(A)+ mRNA was isolated according to Miura et al., ( Clin. Chem ., 1996, 42, 1758-1764). Other methods for poly(A)+mRNA isolation are routine in the art. Briefly, for cells grown on 96-well plates, growth medium was removed from the cells and each well was washed with 200 ?L cold PBS. 60 ?L lysis buffer (10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5% NP-40, 20 mM vanadyl-ribonucleoside complex) was added to each well, the plate was gently agitated and then incubated at room temperature for five minutes. 55 ?L of lysate was transferred to Oligo d(T) coated 96-well plates (AGCT Inc., Irvine Calif.). Plates were incubated for 60 minutes at room temperature, washed 3 times with 200 ?L of wash buffer (10 mM Tris-HCl pH 7.6, 1 mM EDTA, 0.3 M NaCl). After the final wash, the plate was blotted on paper towels to remove excess wash buffer and then air-dried for 5 minutes. 60 ?L of elution buffer (5 mM Tris-HCl pH 7.6), preheated to 70?C, was added to each well, the plate was incubated on a 90?C hot plate for 5 minutes, and the eluate was then transferred to a fresh 96-well plate.
[0180] Cells grown on 100 mm or other standard plates may be treated similarly, using appropriate volumes of all solutions.
[0181] Total RNA Isolation
[0182] Total RNA was isolated using an RNEASY 96? kit and buffers purchased from Qiagen Inc. (Valencia, Calif.) following the manufacturer's recommended procedures. Briefly, for cells grown on 96-well plates, growth medium was removed from the cells and each well was washed with 200 ?L cold PBS. 150 ?L Buffer RLT was added to each well and the plate vigorously agitated for 20 seconds. 150 ?L of 70% ethanol was then added to each well and the contents mixed by pipetting three times up and down. The samples were then transferred to the RNEASY 96? well plate attached to a QIAVAC? manifold fitted with a waste collection tray and attached to a vacuum source. Vacuum was applied for 1 minute. 500 ?L of Buffer RWl was added to each well of the RNEASY 96? plate and incubated for 15 minutes and the vacuum was again applied for 1 minute. An additional 500 ?L of Buffer RW1 was added to each well of the RNEASY 96? plate and the vacuum was applied for 2 minutes. 1 mL of Buffer RPE was then added to each well of the RNEASY 96? plate and the vacuum applied for a period of 90 seconds. The Buffer RPE wash was then repeated and the vacuum was applied for an additional 3 minutes. The plate was then removed from the QIAVAC? manifold and blotted dry on paper towels. The plate was then re-attached to the QIAVAC? manifold fitted with a collection tube rack containing 1.2 mL collection tubes. RNA was then eluted by pipetting 140 ?L of RNAse free water into each well, incubating 1 minute, and then applying the vacuum for 3 minutes.
[0183] The repetitive pipetting and elution steps may be automated using a QIAGEN Bio-Robot 9604 (Qiagen, Inc., Valencia Calif.). Essentially, after lysing of the cells on the culture plate, the plate is transferred to the robot deck where the pipetting, DNase treatment and elution steps are carried out.
Example 13
Real-time Quantitative PCR Analysis of tyrosinase mRNA Levels
[0184] Quantitation of tyrosinase mRNA levels was accomplished by real-time quantitative PCR using the ABI PRISM? 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, Calif.) according to manufacturer's instructions. This is a closed-tube, non-gel-based, fluorescence detection system which allows high-throughput quantitation of polymerase chain reaction (PCR) products in real-time. As opposed to standard PCR in which amplification products are quantitated after the PCR is completed, products in real-time quantitative PCR are quantitated as they accumulate. This is accomplished by including in the PCR reaction an oligonucleotide probe that anneals specifically between the forward and reverse PCR primers, and contains two fluorescent dyes. A reporter dye (e.g., FAM or JOE, obtained from either PE-Applied Biosystems, Foster City, Calif., Operon Technologies Inc., Alameda, Calif. or Integrated DNA Technologies Inc., Coralville, Iowa) is attached to the 5′ end of the probe and a quencher dye (e.g., TAMRA, obtained from either PE-Applied Biosystems, Foster City, Calif., Operon Technologies Inc., Alameda, Calif. or Integrated DNA Technologies Inc., Coralville, Iowa) is attached to the 3′ end of the probe. When the probe and dyes are intact, reporter dye emission is quenched by the proximity of the 31 quencher dye. During amplification, annealing of the probe to the target sequence creates a substrate that can be cleaved by the 5′-exonuclease activity of Taq polymerase. During the extension phase of the PCR amplification cycle, cleavage of the probe by Taq polymerase releases the reporter dye from the remainder of the probe (and hence from the quencher moiety) and a sequence-specific fluorescent signal is generated. With each cycle, additional reporter dye molecules are cleaved from their respective probes, and the fluorescence intensity is monitored at regular intervals by laser optics built into the ABI PRISM? Sequence Detection System. In each assay, a series of parallel reactions containing serial dilutions of mRNA from untreated control samples generates a standard curve that is used to quantitate the percent inhibition after antisense oligonucleotide treatment of test samples.
[0185] Prior to quantitative PCR analysis, primer-probe sets specific to the target gene being measured are evaluated for their ability to be “multiplexed” with a GAPDH amplification reaction. In multiplexing, both the target gene and the internal standard gene GAPDH are amplified concurrently in a single sample. In this analysis, mRNA isolated from untreated cells is serially diluted. Each dilution is amplified in the presence of primer-probe sets specific for GAPDH only, target gene only (“single-plexing”), or both (multiplexing). Following PCR amplification, standard curves of GAPDH and target mRNA signal as a function of dilution are generated from both the single-plexed and multiplexed samples. If both the slope and correlation coefficient of the GAPDH and target signals generated from the multiplexed samples fall within 10% of their corresponding values generated from the single-plexed samples, the primer-probe set specific for that target is deemed multiplexable. Other methods of PCR are also known in the art.
[0186] PCR reagents were obtained from Invitrogen Corporation, (Carlsbad, Calif.). RT-PCR reactions were carried out by adding 20 ?L PCR cocktail (2.5×PCR buffer minus MgCl 2 , 6.6 mM MgCl 2 , 375 ?M each of DATP, dCTP, dCTP and dGTP, 375 nM each of forward primer and reverse primer, 125 nM of probe, 4 Units RNAse inhibitor, 1.25 Units PLATINUM® Taq, 5 Units MuLV reverse transcriptase, and 2.5×ROX dye) to 96-well plates containing 30 ?L total RNA solution (20-200 ng). The RT reaction was carried out by incubation for 30 minutes at 48?C. Following a 10 minute incubation at 95?C to activate the PLATINUM® Taq, 40 cycles of a two-step PCR protocol were carried out: 95?C for 15 seconds (denaturation) followed by 60?C for 1.5 minutes (annealing/extension).
[0187] Gene target quantities obtained by real time RT-PCR are normalized using either the expression level of GAPDH, a gene whose expression is constant, or by quantifying total RNA using RiboGreen™ (Molecular Probes, Inc. Eugene, Oreg.). GAPDH expression is quantified by real time RT-PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RiboGreen™ RNA quantification reagent (Molecular Probes, Inc. Eugene, Oreg.). Methods of RNA quantification by RiboGreen™ are taught in Jones, L. J., et al, (Analytical Biochemistry, 1998, 265, 368-374).
[0188] In this assay, 170 ?L of RiboGreen T M working reagent (RiboGreen™ reagent diluted 1:350 in 10 mM Tris-HCl, 1 mM EDTA, pH 7.5) is pipetted into a 96-well plate containing 30 ?L purified, cellular RNA. The plate is read in a CytoFluor 4000 (PE Applied Biosystems) with excitation at 485 nm and emission at 530 nm.
[0189] Probes and primers to human tyrosinase were designed to hybridize to a human tyrosinase sequence, using published sequence information (GenBank accession number M27160.1, incorporated herein as SEQ ID NO:4). For human tyrosinase the PCR primers were:
[0190] forward primer: GCCTGCTGTGGAGTTTCCA (SEQ ID NO: 5)
[0191] reverse primer: TCCATCAGGTTCTTAGAGGAGACA (SEQ ID NO: 6) and the PCR probe was: FAM-TCCGCTGGCCATTTCCCTAGAGC-TAMRA (SEQ ID NO: 7) where FAM is the fluorescent dye and TAMRA is the quencher dye. For human GAPDH the PCR primers were:
[0192] forward primer: GAAGGTGAAGGTCGGAGTC(SEQ ID NO:8)
[0193] reverse primer: GAAGATGGTGATGGGATTTC (SEQ ID NO:9) and the PCR probe was: 5′ JOE-CAAGCTTCCCGTTCTCAGCC- TAMRA 3′ (SEQ ID NO: 10) where JOE is the fluorescent reporter dye and TAMRA is the quencher dye.
[0194] Probes and primers to mouse tyrosinase were designed to hybridize to a mouse tyrosinase sequence, using published sequence information (GenBank accession number NM — 011661.1, incorporated herein as SEQ ID NO:11). For mouse tyrosinase the PCR primers were:
[0195] forward primer: TCGAGCCTGTGCCTCCTCTA (SEQ ID NO:12)
[0196] reverse primer: GACTCCCATCACCCATCCAT (SEQ ID NO: 13) and the PCR probe was: FAM-TTGTTGGCAAAAGAATGCTGCCCAC-TAMRA (SEQ ID NO: 14) where FAM is the fluorescent reporter dye and TAMRA is the quencher dye. For mouse GAPDH the PCR primers were:
[0197] forward primer: GGCAAATTCAACGGCACAGT(SEQ ID NO:15)
[0198] reverse primer: GGGTCTCGCTCCTGGAAGAT(SEQ ID NO:16) and the PCR probe was: 5′ JOE-AAGGCCGAGAATGGGAAGCTTGTCATC- TAMRA 3′ (SEQ ID NO: 17) where JOE is the fluorescent reporter dye and TAMRA is the quencher dye.
Example 14
Northern Blot Analysis of Tyrosinase mRNA Levels
[0199] Eighteen hours after antisense treatment, cell monolayers were washed twice with cold PBS and lysed in 1 mL RNAZOL? (TEL-TEST “B” Inc., Friendswood, Tex.). Total RNA was prepared following manufacturer's recommended protocols. Twenty micrograms of total RNA was fractionated by electrophoresis through 1.2% agarose gels containing 1.1% formaldehyde using a MOPS buffer system (AMRESCO, Inc. Solon, Ohio). RNA was transferred from the gel to HYBOND? −N+nylon membranes (Amersham Pharmacia Biotech, Piscataway, N.J.) by overnight capillary transfer using a Northern/Southern Transfer buffer system (TEL-TEST “B” Inc., Friendswobd, Tex.). RNA transfer was confirmed by UV visualization. Membranes were fixed by UV cross-linking using a STRATALINKER? UV Crosslinker 2400 (Stratagene, Inc, La Jolla, Calif.) and then probed using QUICKHYB? hybridization solution (Stratagene, La Jolla, Calif.) using manufacturer's recommendations for stringent conditions.
[0200] To detect human tyrosinase, a human tyrosinase specific probe was prepared by PCR using the forward primer GCCTGCTGTGGAGTTTCCA (SEQ ID NO: 5) and the reverse primer TCCATCAGGTTCTTAGAGGAGACA (SEQ ID NO: 6). To normalize for variations in loading and transfer efficiency membranes were stripped and probed for human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RNA (Clontech, Palo Alto, Calif.).
[0201] To detect mouse tyrosinase, a mouse tyrosinase specific probe was prepared by PCR using the forward primer TCGAGCCTGTGCCTCCTCTA (SEQ ID NO: 12) and the reverse primer GACTCCCATCACCCATCCAT (SEQ ID NO: 13). To normalize for variations in loading and transfer efficiency membranes were stripped and probed for mouse glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RNA (Clontech, Palo Alto, Calif.).
[0202] Hybridized membranes were visualized and quantitated using a PHOSPHORIMAGER? and IMAGEQUANT? Software V3.3 (Molecular Dynamics, Sunnyvale, Calif.). Data was normalized to GAPDH levels in untreated controls.
Example 15
Antisense Inhibition of Human Tyrosinase Expression by Chimeric Phosphorothioate Oligonucleotides having 2′-MOE Wings and a Deoxy Gap
[0203] In accordance with the present invention, a series of antisense compounds were designed to target different regions of the human tyrosinase RNA, using published sequences (GenBank accession number M27160.1, incorporated herein as SEQ ID NO: 4). The compounds are shown in Table 1. “Target site” indicates the first (5′-most) nucleotide number on the particular target sequence to which the compound binds. All compounds in Table 1 are chimeric oligonucleotides (“gapmers”) 20 nucleotides in length, composed of a central “gap” region consisting of ten 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′ directions) by five-ide nucleotide “wings”. The wings are composed of 2′-ethyl methoxyethyl (2′-MOE)nucleotides. The internucleoside (backbone) linkages are phosphorothioate (P═S) throughout the oligonucleotide. All cytidine residues are 5-ytidines. methylcytidines. The compounds were analyzed for their effect on human tyrosinase mRNA levels by quantitative real-R time PCR as described in other examples herein. Data are averages from three experiments in which G-361 cells were treated with the antisense oligonucleotides of the present invention. The positive control for each datapoint is identified in the table by sequence ID number. If present, “N.D.” indicates “no data”.
TABLE 1 Inhibition of human tyrosinase mRNA levels by chimeric phosphorothioate oligonucleotides having 2′-MOE wings and a deoxy gap TARGET TARGET SEQ ID ISIS # REGION SEQ ID NO SITE SEQUENCE % INHIB NO 149478 Coding 4 641 cctctgcctgaaagctggcc 81 19 149481 Coding 4 752 tggcaggtcctattataaaa 74 20 149485 Coding 4 1091 tcatgggcaaaatcaatgtc 82 21 149486 Coding 4 1099 ctggtgcttcatgggcaaaa 88 22 149487 Coding 4 1232 tcatctgtgcaaatgtcaca 65 23 149488 Coding 4 1276 ggctgagtaagttaggattt 83 24 149489 Coding 4 1397 tcatggtttccaggattacg 85 25 149490 Coding 4 1506 tctaaagctgaaattggcag 62 26 149491 Coding 4 1609 gggacattgttccattcata 82 27 149493 Stop 4 2091 ctctattgcctaagcctttt 24 28 Codon 149719 5′UTR 4 114 ttgcaaatgagaggtagtgt 15 29 149720 5′UTR 4 164 gacctaagcaaacccagtta 17 30 149721 5′UTR 4 212 attcttatggttagaatatt 16 31 149725 5′UTR 4 451 ctggctaattggagtcacag 81 32 149730 3′UTR 4 2099 tggccctactctattgccta 60 33 149731 3′UTR 4 2120 ttagagtgaggtcaggcttt 70 34 149735 3′UTR 4 2282 ggaaaatgttaaaagggctg 67 35 149736 3′UTR 4 2330 gttcctcattaccaaatagc 72 36 149742 5′UTR 4 20 gagaccataaagaggctaca 23 37 149743 5′UTR 4 97 tgtcaggaatagagcttctc 43 38 149744 5′UTR 4 316 ctctgaaaagcacatgactg 21 39 149745 5′UTR 4 398 cacatgtcttggctgagacc 20 40 149746 Coding 4 758 gagcactggcaggtcctatt 89 41 149747 Coding 4 1283 gatgctgggctgagtaagtt 65 42 149748 Stop 4 2078 gccttttataaatggctctg 64 43 Codon 149749 3′UTR 4 2222 gttggaagaaggctacactt 74 44 149750 3′UTR 4 2230 ctacctgagttggaagaagg 69 45 149751 3′UTR 4 2265 ctgagtgaaaacagcaagac 73 46
[0204] As shown in Table 1, SEQ ID NOs 19, 20, 21, 22, 23, 24, 25, 26, 27, 32, 33, 34, 35, 36, 41, 42, 43, 44, 45 and 46 demonstrated at least 60% inhibition of human tyrosinase expression in this assay and are therefore preferred. More preferred are SEQ ID NOs 22 and 24. The target regions to which these preferred sequences are complementary are herein referred to as “preferred target segments” and are therefore preferred for targeting by compounds of the present invention. These preferred target segments are shown in Table 3. The sequences represent the reverse complement of the preferred antisense compounds shown in Table 1. “Target site” indicates the first (5′-most) nucleotide number on the particular target nucleic acid to which the oligonucleotide binds. Also shown in Table 3 is the species in which each of the preferred target segments was found.
Example 16
Antisense Inhibition of Mouse Tyrosinase Expression by Chimeric Phosphorothioate Oligonucleotides having 2′-MOE Wings and a Deoxy Gap.
[0205] In accordance with the present invention, a second series of antisense compounds were designed to target different regions of the mouse tyrosinase RNA, using published sequences (GenBank accession number NM — 011661.1, incorporated herein as SEQ ID NO: 11, GenBank accession number X51743.1, incorporated herein as SEQ ID NO: 47, and GenBank accession number D00131.1, incorporated herein as SEQ ID NO: 48). The compounds are shown in Table 2. “Target site” indicates the first (5′-most) nucleotide number on the particular target nucleic acid to which the compound binds. All compounds in Table 2 are chimeric oligonucleotides (“gapmers”) 20 nucleotides in length, composed of a central “gap” region consisting of ten 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′ directions) by five-nucleotide “wings”. The wings are composed of 2′-methoxyethyl (2′-MOE)nucleotides. The internucleoside (backbone) linkages are phosphorothioate (P═S) throughout the oligonucleotide. All cytidine residues are 5-methylcytidines. The compounds were analyzed for their effect on mouse tyrosinase mRNA levels by quantitative real-time PCR as described in other examples herein. Data are averages from three experiments in which B16-F10 cells were treated with the antisense oligonucleotides of the present invention. The positive control for each datapoint is identified in the table by sequence ID number. If present, “N.D.” indicates “no data”.
TABLE 2 Inhibition of mouse tyrosinase mRNA levels by chimeric phosphorothioate oligonucleotides having 2′-MOE wings and a deoxy gap TARGET CONTROL SEQ ID TARGET % SEQ ID SEQ ID ISIS # REGION NO SITE SEQUENCE INHIB NO NO 191483 Start 11 48 gaacatttctcctttagatc 47 49 1 Codon 191484 Start 11 54 agccaagaacatttctcctt 63 50 1 Codon 191485 Coding 11 97 ggccatcagagatctggaaa 75 51 1 191486 Coding 11 109 ctcgaggaaaatggccatca 74 52 1 191487 Coding 11 139 ttgccaacaagttcttagag 80 53 1 191488 Coding 11 205 aggaacctctgcctgaaagc 69 54 1 191489 Coding 11 290 acagagggccaggactcacg 78 55 1 191490 Coding 11 316 agcactggcaggtcctatta 79 56 1 191491 Coding 11 346 ttccgcagttgaaacccatg 84 57 1 191492 Coding 11 371 gggcccccaaatccaaactt 78 58 1 191493 Coding 11 378 acaatttgggcccccaaatc 68 59 1 191494 Coding 11 474 agtatgttttgctaaagtga 78 60 1 191495 Coding 11 482 gagctgatagtatgttttgc 86 61 1 191496 Coding 11 496 ggatgacatagactgagctg 83 62 1 191497 Coding 11 518 atttggccataggtgcctgt 65 63 1 191498 Coding 11 536 ggtgttgacccattgttcat 45 64 1 191500 Coding 11 603 tgtgtcccttgacacatagt 43 65 1 191501 Coding 11 655 gtgcttcatgggcaaaatca 75 66 1 191502 Coding 11 686 aagaaaagtctgtgccaagg 4 67 1 191503 Coding 11 731 ttctcatccccagttagttc 49 68 1 191504 Coding 11 840 tgctgggctgagtaagttag 82 69 1 191505 Coding 11 878 gatctgctacaaatgatctg 75 70 1 191506 Coding 11 897 atggctattatactcttctg 83 71 1 191507 Coding 11 1033 atccagattcatactgggtc 78 72 1 191508 Coding 11 1133 ttgtgcatgctactttgaga 70 73 1 191510 Coding 11 1139 aaggcattgtgcatgctact 82 74 1 191512 Coding 11 1156 cattcataaagatatgtaag 33 75 1 191513 Coding 11 1224 gtccacaaaagcatggtgaa 57 76 1 191514 Coding 11 1296 gataggtgcattggcttctg 53 77 1 191515 Coding 11 1330 tgaaaggaaccatgtaagag 28 78 1 191516 Coding 11 1375 gatccttggatgttatgaag 38 79 1 191517 Coding 11 1394 tagctgtagtcatatcccag 59 80 1 191518 Coding 11 1432 tataatttctgtaaaagcct 50 81 1 191519 Coding 11 1484 gccccaagaagccatggcca 62 82 1 191520 Coding 11 1525 gcccagagagagctgcagca 69 83 1 191521 Coding 11 1621 agctgtggtagtcgtctttg 66 84 1 191522 Stop 11 1652 taggatgttcacagatggct 75 85 1 Codon 191523 3′UTR 11 1667 tcccactctgtttcctagga 90 86 1 191524 3′UTR 11 1822 atatattttagcaaatccca 57 87 1 191525 3′UTR 11 1866 aggaaattttatttagctat 69 88 1 191526 3′UTR 11 1890 aaaaccagctcaattagttg 24 89 1 191527 3′UTR 11 1923 gcctcaagtttaaataatta 27 90 1 191528 3′UTR 11 1928 aatgtgcctcaagtttaaat 39 91 1 191529 3′UTR 11 1962 tcttggaaattcacaatgaa 56 92 1 191530 3′UTR 11 2043 caagattttcaaaattgttt 4 93 1 191531 3′UTR 11 2099 ctttcctaatcattaatgaa 58 94 1 191532 3′UTR 11 2207 cctgatatttttccaccagt 52 95 1 191533 3′UTR 11 2367 tttcagattgcagtcaagcc 55 96 1 191534 3′UTR 11 2402 gctgttcccattcctttggc 57 97 1 191535 3′UTR 11 2446 cctgacactatcacactaga 42 98 1 191536 3′UTR 11 2483 caacaggtgtgaaggtctca 83 99 1 191537 3′UTR 11 2489 gtgactcaacaggtgtgaag 56 100 1 191538 3′UTR 11 2520 cagtaaaaatttacattcac 49 101 1 191539 3′UTR 11 2793 gcttcctaaaattttactaa 60 102 1 191540 3′UTR 11 2806 aaactaaaaatttgcttcct 20 103 1 191541 3′UTR 11 2869 cttgcattgcatatacaagg 66 104 1 191542 3′UTR 11 2877 agaaaatgcttgcattgcat 76 105 1 191543 3′UTR 11 2905 atatatacatgctaggtagc 70 106 1 191544 3′UTR 11 2950 ataaagacccttgtcagctg 79 107 1 191545 3′UTR 11 3049 atacataccttgaaccgcta 73 108 1 191546 3′UTR 11 3056 tatacaaatacataccttga 32 109 1 191547 3′UTR 11 3114 ttaccataatgagatatata 15 110 1 191548 3′UTR 11 3147 cagatatattgaaatagtca 72 111 1 191549 3′UTR 11 3167 tgagaatttaatgaaacttt 40 112 1 191550 3′UTR 11 3267 tttcttaacagaatgatgta 62 113 1 191551 5′UTR 47 23 catttatagaactcattttg 0 114 1 191552 5′UTR 47 100 cttatgaataaaggtcatga 0 115 1 191553 5′UTR 47 259 tttatcttctgcaaagcaca 0 116 1 191554 Coding 48 1096 gttcaaacaaaaatacttcc 0 117 1
[0206] As shown in Table 2, SEQ ID NOs 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 66, 69, 70, 71, 72, 73, 74, 76, 77, 80, 81, 82, 83, 84, 85, 86, 87, 88, 92, 94, 95, 96, 97, 99, 100, 102, 104, 105, 106, 107, 108, 111 and 113 demonsrated at least 50% inhibition of mouse tyrosinase expression in this experiment and are therefore preferred. The target regions to which these preferred sequences are complementary are herein referred to as “preferred target segments” and are therefore preferred for targeting by compounds of the present invention. These preferred target segments are shown in Table 3. The sequences represent the reverse complement of the preferred antisense compounds shown in Tables 1 and 2. These sequences are shown to contain thymine (T) but one of skill in the art will appreciate that thymine (T) is generally replaced by uracil (U) in RNA sequences. “Target site” indicates the first (5′-most) nucleotide number on the particular target nucleic acid to which the oligonucleotide binds. Also shown in Table 3 is the species in which each of the preferred target segments was found.
TABLE 3 Sequence and position of preferred target segments identified in tyrosinase. TARGET SITE SEQ ID TARGET REV COMP SEQ ID ID NO SITE SEQUENCE OF SEQ ID ACTIVE IN NO 64890 4 641 ggccagctttcaggcagagg 19 H. sapiens 118 64893 4 752 ttttataataggacctgcca 20 H. sapiens 119 64897 4 1091 gacattgattttgcccatga 21 H. sapiens 120 64898 4 1099 ttttgcccatgaagcaccag 22 H. sapiens 121 64899 4 1232 tgtgacatttgcacagatga 23 H. sapiens 122 64900 4 1276 aaatcctaacttactcagcc 24 H. sapiens 123 64901 4 1397 cgtaatcctggaaaccatga 25 H. sapiens 124 64902 4 1506 ctgccaatttcagctttaga 26 H. sapiens 125 64903 4 1609 tatgaatggaacaatgtccc 27 H. sapiens 126 65126 4 451 ctgtgactccaattagccag 32 H. sapiens 127 65131 4 2099 taggcaatagagtagggcca 33 H. sapiens 128 65132 4 2120 aaagcctgacctcactctaa 34 H. sapiens 129 65136 4 2282 cagcccttttaacattttcc 35 H. sapiens 130 65137 4 2330 gctatttggtaatgaggaac 36 H. sapiens 131 65147 4 758 aataggacctgccagtgctc 41 H. sapiens 132 65148 4 1283 aacttactcagcccagcatc 42 H. sapiens 133 65149 4 2078 cagagccatttataaaaggc 43 H. sapiens 134 65150 4 2222 aagtgtagccttcttccaac 44 H. sapiens 135 65151 4 2230 ccttcttccaactcaggtag 45 H. sapiens 136 65152 4 2265 gtcttgctgttttcactcag 46 H. sapiens 137 107916 11 54 aaggagaaatgttcttggct 50 M. musculus 138 107917 11 97 tttccagatctctgatggcc 51 M. musculus 139 107918 11 109 tgatggccattttcctcgag 52 M. musculus 140 107919 11 139 ctctaagaacttgttggcaa 53 M. musculus 141 107920 11 205 gctttcaggcagaggttcct 54 M. musculus 142 107921 11 290 cgtgagtcctggccctctgt 55 M. musculus 143 107922 11 316 taataggacctgccagtgct 56 M. musculus 144 107923 11 346 catgggtttcaactgcggaa 57 M. musculus 145 107924 11 371 aagtttggatttgggggccc 58 M. musculus 146 107925 11 378 gatttgggggcccaaattgt 59 M. musculus 147 107926 11 474 tcactttagcaaaacatact 60 M. musculus 148 107927 11 482 gcaaaacatactatcagctc 61 M. musculus 149 107928 11 496 cagctcagtctatgtcatcc 62 M. musculus 150 107929 11 518 acaggcacctatggccaaat 63 M. musculus 151 107933 11 655 tgattttgcccatgaagcac 66 M. musculus 152 107936 11 840 ctaacttactcagcccagca 69 M. musculus 153 107937 11 878 cagatcatttgtagcagatc 70 M. musculus 154 107938 11 897 cagaagagtataatagccat 71 M. musculus 155 107939 11 1033 gacccagtatgaatctggat 72 M. musculus 156 107940 11 1133 tctcaaagtagcatgcacaa 73 M. musculus 157 107941 11 1139 agtagcatgcacaatgcctt 74 M. musculus 158 107943 11 1224 ttcaccatgcttttgtggac 76 M. musculus 159 107944 11 1296 cagaagccaatgcacctatc 77 M. musculus 160 107947 11 1394 ctgggatatgactacagcta 80 M. musculus 161 107948 11 1432 aggcttttacagaaattata 81 M. musculus 162 107949 11 1484 tggccatggcttcttggggc 82 M. musculus 163 107950 11 1525 tgctgcagctctctctgggc 83 M. musculus 164 107951 11 1621 caaagacgactaccacagct 84 M. musculus 165 107952 11 1652 agccatctgtgaacatccta 85 M. musculus 166 107953 11 1667 tcctaggaaacagagtggga 86 M. musculus 167 107954 11 1822 tgggatttgctaaaatatat 87 M. musculus 168 107955 11 1866 atagctaaataaaatttcct 88 M. musculus 169 107959 11 1962 ttcattgtgaatttccaaga 92 M. musculus 170 107961 11 2099 ttcattaatgattaggaaag 94 M. musculus 171 107962 11 2207 actggtggaaaaatatcagg 95 M. musculus 172 107963 11 2367 ggcttgactgcaatctgaaa 96 M. musculus 173 107964 11 2402 gccaaaggaatgggaacagc 97 M. musculus 174 107966 11 2483 tgagaccttcacacctgttg 99 M. musculus 175 107967 11 2489 cttcacacctgttgagtcac 100 M. musculus 176 107969 11 2793 ttagtaaaattttaggaagc 102 M. musculus 177 107971 11 2869 ccttgtatatgcaatgcaag 104 M. musculus 178 107972 11 2877 atgcaatgcaagcattttct 105 M. musculus 179 107973 11 2905 gctacctagcatgtatatat 106 M. musculus 180 107974 11 2950 cagctgacaagggtctttat 107 M. musculus 181 107975 11 3049 tagcggttcaaggtatgtat 108 M. musculus 182 107978 11 3147 tgactatttcaatatatctg 111 M. musculus 183 107980 11 3267 tacatcattctgttaagaaa 113 M. musculus 184
[0207] As these “preferred target segments” have been found by expermentation to be open to, and accessible for, hybridization with the antisense compounds of the present invention, one of skill in the art will recognize or be able to ascertain, using no more than routine experimentation, further embodiments of the invention that encompass other compounds that specifically hybridize to these preferred target segments and consequently inhibit the expression of tyrosinase.
[0208] Acccording to the present invention, antisense compounds include antisense oligomeric compounds, antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, alternate splicers, primers, probes, and other short oligomeric compounds which hybridize to at least a portion of the target nucleic acid.
Example 17
Western blot analysis of tyrosinase protein levels
[0209] Western blot analysis (immunoblot analysis) is carried out using standard methods. Cells are harvested 16-20 h after oligonucleotide treatment, washed once with PBS, suspended in Laemmli buffer (100 ul/well), boiled for 5 minutes and loaded on a 16% SDS-PAGE gel. Gels are run for 1.5 hours at 150 V, and transferred to membrane for western blotting. Appropriate primary antibody directed to tyrosinase is used, with a radiolabeled or fluorescently labeled secondary antibody directed against the primary antibody species. Bands are visualized using a PHOSPHORIMAGER? (Molecular Dynamics, Sunnyvale Calif.).
0
SEQUENCE LISTING
<160> NUMBER OF SEQ ID NOS: 184
<210> SEQ ID NO 1
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 1
tccgtcatcg ctcctcaggg 20
<210> SEQ ID NO 2
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 2
gtgcgcgcga gcccgaaatc 20
<210> SEQ ID NO 3
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 3
atgcattctg cccccaagga 20
<210> SEQ ID NO 4
<211> LENGTH: 2384
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<221> NAME/KEY: CDS
<222> LOCATION: (503)...(2092)
<400> SEQUENCE: 4
tattgagttc ttcaaacatt gtagcctctt tatggtctct gagaaataac taccttaaac 60
ccataatctt taatacttcc taaactttct taataagaga agctctattc ctgacactac 120
ctctcatttg caaggtcaaa tcatcattag ttttgtagtc tattaactgg gtttgcttag 180
gtcaggcatt attattacta accttattgt taatattcta accataagaa ttaaactatt 240
aatggtgaat agagtttttc actttaacat aggcctatcc cactggtggg atacgagcca 300
attcgaaaga aaagtcagtc atgtgctttt cagaggatga aagcttaaga taaagactaa 360
aagtgtttga tgctggaggt gggagtggta ttatataggt ctcagccaag acatgtgata 420
atcactgtag tagtagctgg aaagagaaat ctgtgactcc aattagccag ttcctgcaga 480
ccttgtgagg actagaggaa ga atg ctc ctg gct gtt ttg tac tgc ctg ctg 532
Met Leu Leu Ala Val Leu Tyr Cys Leu Leu
1 5 10
tgg agt ttc cag acc tcc gct ggc cat ttc cct aga gcc tgt gtc tcc 580
Trp Ser Phe Gln Thr Ser Ala Gly His Phe Pro Arg Ala Cys Val Ser
15 20 25
tct aag aac ctg atg gag aag gaa tgc tgt cca ccg tgg agc ggg gac 628
Ser Lys Asn Leu Met Glu Lys Glu Cys Cys Pro Pro Trp Ser Gly Asp
30 35 40
agg agt ccc tgt ggc cag ctt tca ggc aga ggt tcc tgt cag aat atc 676
Arg Ser Pro Cys Gly Gln Leu Ser Gly Arg Gly Ser Cys Gln Asn Ile
45 50 55
ctt ctg tcc aat gca cca ctt ggg cct caa ttt ccc ttc aca ggg gtg 724
Leu Leu Ser Asn Ala Pro Leu Gly Pro Gln Phe Pro Phe Thr Gly Val
60 65 70
gat gac cgg gag tcg tgg cct tcc gtc ttt tat aat agg acc tgc cag 772
Asp Asp Arg Glu Ser Trp Pro Ser Val Phe Tyr Asn Arg Thr Cys Gln
75 80 85 90
tgc tct ggc aac ttc atg gga ttc aac tgt gga aac tgc aag ttt ggc 820
Cys Ser Gly Asn Phe Met Gly Phe Asn Cys Gly Asn Cys Lys Phe Gly
95 100 105
ttt tgg gga cca aac tgc aca gag aga cga ctc ttg gtg aga aga aac 868
Phe Trp Gly Pro Asn Cys Thr Glu Arg Arg Leu Leu Val Arg Arg Asn
110 115 120
atc ttc gat ttg agt gcc cca gag aag gac aaa ttt ttt gcc tac ctc 916
Ile Phe Asp Leu Ser Ala Pro Glu Lys Asp Lys Phe Phe Ala Tyr Leu
125 130 135
act tta gca aag cat acc atc agc tca gac tat gtc atc ccc ata ggg 964
Thr Leu Ala Lys His Thr Ile Ser Ser Asp Tyr Val Ile Pro Ile Gly
140 145 150
acc tat ggc caa atg aaa aat gga tca aca ccc atg ttt aac gac atc 1012
Thr Tyr Gly Gln Met Lys Asn Gly Ser Thr Pro Met Phe Asn Asp Ile
155 160 165 170
aat att tat gac ctc ttt gtc tgg atg cat tat tat gtg tca atg gat 1060
Asn Ile Tyr Asp Leu Phe Val Trp Met His Tyr Tyr Val Ser Met Asp
175 180 185
gca ctg ctt ggg gga tct gaa atc tgg aga gac att gat ttt gcc cat 1108
Ala Leu Leu Gly Gly Ser Glu Ile Trp Arg Asp Ile Asp Phe Ala His
190 195 200
gaa gca cca gct ttt ctg cct tgg cat aga ctc ttc ttg ttg cgg tgg 1156
Glu Ala Pro Ala Phe Leu Pro Trp His Arg Leu Phe Leu Leu Arg Trp
205 210 215
gaa caa gaa atc cag aag ctg aca gga gat gaa aac ttc act att cca 1204
Glu Gln Glu Ile Gln Lys Leu Thr Gly Asp Glu Asn Phe Thr Ile Pro
220 225 230
tat tgg gac tgg cgg gat gca gaa aag tgt gac att tgc aca gat gag 1252
Tyr Trp Asp Trp Arg Asp Ala Glu Lys Cys Asp Ile Cys Thr Asp Glu
235 240 245 250
tac atg gga ggt cag cac ccc aca aat cct aac tta ctc agc cca gca 1300
Tyr Met Gly Gly Gln His Pro Thr Asn Pro Asn Leu Leu Ser Pro Ala
255 260 265
tca ttc ttc tcc tct tgg cag att gtc tgt agc cga ttg gag gag tac 1348
Ser Phe Phe Ser Ser Trp Gln Ile Val Cys Ser Arg Leu Glu Glu Tyr
270 275 280
aac agc cat cag tct tta tgc aat gga acg ccc gag gga cct tta cgg 1396
Asn Ser His Gln Ser Leu Cys Asn Gly Thr Pro Glu Gly Pro Leu Arg
285 290 295
cgt aat cct gga aac cat gac aaa tcc aga acc cca agg ctc ccc tct 1444
Arg Asn Pro Gly Asn His Asp Lys Ser Arg Thr Pro Arg Leu Pro Ser
300 305 310
tca gct gat gta gaa ttt tgc ctg agt ttg acc caa tat gaa tct ggt 1492
Ser Ala Asp Val Glu Phe Cys Leu Ser Leu Thr Gln Tyr Glu Ser Gly
315 320 325 330
tcc atg gat aaa gct gcc aat ttc agc ttt aga aat aca ctg gaa gga 1540
Ser Met Asp Lys Ala Ala Asn Phe Ser Phe Arg Asn Thr Leu Glu Gly
335 340 345
ttt gct agt cca ctt act ggg ata gcg gat gcc tct caa agc agc atg 1588
Phe Ala Ser Pro Leu Thr Gly Ile Ala Asp Ala Ser Gln Ser Ser Met
350 355 360
cac aat gcc ttg cac atc tat atg aat gga aca atg tcc cag gta cag 1636
His Asn Ala Leu His Ile Tyr Met Asn Gly Thr Met Ser Gln Val Gln
365 370 375
gga tct gcc aac gat cct atc ttc ctt ctt cac cat gca ttt gtt gac 1684
Gly Ser Ala Asn Asp Pro Ile Phe Leu Leu His His Ala Phe Val Asp
380 385 390
agt att ttt gag cag tgg ctc cga agg cac cgt cct ctt caa gaa gtt 1732
Ser Ile Phe Glu Gln Trp Leu Arg Arg His Arg Pro Leu Gln Glu Val
395 400 405 410
tat cca gaa gcc aat gca ccc att gga cat aac cgg gaa tcc tac atg 1780
Tyr Pro Glu Ala Asn Ala Pro Ile Gly His Asn Arg Glu Ser Tyr Met
415 420 425
gtt cct ttt ata cca ctg tac aga aat ggt gat ttc ttt att tca tcc 1828
Val Pro Phe Ile Pro Leu Tyr Arg Asn Gly Asp Phe Phe Ile Ser Ser
430 435 440
aaa gat ctg ggc tat gac tat agc tat cta caa gat tca gac cca gac 1876
Lys Asp Leu Gly Tyr Asp Tyr Ser Tyr Leu Gln Asp Ser Asp Pro Asp
445 450 455
tct ttt caa gac tac att aag tcc tat ttg gaa caa gcg agt cgg atc 1924
Ser Phe Gln Asp Tyr Ile Lys Ser Tyr Leu Glu Gln Ala Ser Arg Ile
460 465 470
tgg tca tgg ctc ctt ggg gcg gcg atg gta ggg gcc gtc ctc act gcc 1972
Trp Ser Trp Leu Leu Gly Ala Ala Met Val Gly Ala Val Leu Thr Ala
475 480 485 490
ctg ctg gca ggg ctt gtg agc ttg ctg tgt cgt cac aag aga aag cag 2020
Leu Leu Ala Gly Leu Val Ser Leu Leu Cys Arg His Lys Arg Lys Gln
495 500 505
ctt cct gaa gaa aag cag cca ctc ctc atg gag aaa gag gat tac cac 2068
Leu Pro Glu Glu Lys Gln Pro Leu Leu Met Glu Lys Glu Asp Tyr His
510 515 520
agc ttg tat cag agc cat tta taa aaggcttagg caatagagta gggccaaaaa 2122
Ser Leu Tyr Gln Ser His Leu *
525
gcctgacctc actctaactc aaagtaatgt ccaggttccc agagaatatc tgctggtatt 2182
tttctgtaaa gaccatttgc aaaattgtaa cctaatacaa agtgtagcct tcttccaact 2242
caggtagaac acacctgtct ttgtcttgct gttttcactc agccctttta acattttccc 2302
ctaagcccat atgtctaagg aaaggatgct atttggtaat gaggaactgt tatttgtatg 2362
tgaattaaag tgctcttatt tt 2384
<210> SEQ ID NO 5
<211> LENGTH: 19
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: PCR Primer
<400> SEQUENCE: 5
gcctgctgtg gagtttcca 19
<210> SEQ ID NO 6
<211> LENGTH: 24
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: PCR Primer
<400> SEQUENCE: 6
tccatcaggt tcttagagga gaca 24
<210> SEQ ID NO 7
<211> LENGTH: 23
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: PCR Probe
<400> SEQUENCE: 7
tccgctggcc atttccctag agc 23
<210> SEQ ID NO 8
<211> LENGTH: 19
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: PCR Primer
<400> SEQUENCE: 8
gaaggtgaag gtcggagtc 19
<210> SEQ ID NO 9
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: PCR Primer
<400> SEQUENCE: 9
gaagatggtg atgggatttc 20
<210> SEQ ID NO 10
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: PCR Probe
<400> SEQUENCE: 10
caagcttccc gttctcagcc 20
<210> SEQ ID NO 11
<211> LENGTH: 3308
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<221> NAME/KEY: CDS
<222> LOCATION: (62)...(1663)
<400> SEQUENCE: 11
caaagaagac tgtgacactc attaacctat tggtgcagat tttgtatgat ctaaaggaga 60
a atg ttc ttg gct gtt ttg tat tgc ctt ctg tgg agt ttc cag atc tct 109
Met Phe Leu Ala Val Leu Tyr Cys Leu Leu Trp Ser Phe Gln Ile Ser
1 5 10 15
gat ggc cat ttt cct cga gcc tgt gcc tcc tct aag aac ttg ttg gca 157
Asp Gly His Phe Pro Arg Ala Cys Ala Ser Ser Lys Asn Leu Leu Ala
20 25 30
aaa gaa tgc tgc cca cca tgg atg ggt gat ggg agt ccc tgc ggc cag 205
Lys Glu Cys Cys Pro Pro Trp Met Gly Asp Gly Ser Pro Cys Gly Gln
35 40 45
ctt tca ggc aga ggt tcc tgc cag gat atc ctt ctg tcc agt gca cca 253
Leu Ser Gly Arg Gly Ser Cys Gln Asp Ile Leu Leu Ser Ser Ala Pro
50 55 60
tct gga cct cag ttc ccc ttc aaa ggg gtg gat gac cgt gag tcc tgg 301
Ser Gly Pro Gln Phe Pro Phe Lys Gly Val Asp Asp Arg Glu Ser Trp
65 70 75 80
ccc tct gtg ttt tat aat agg acc tgc cag tgc tca ggc aac ttc atg 349
Pro Ser Val Phe Tyr Asn Arg Thr Cys Gln Cys Ser Gly Asn Phe Met
85 90 95
ggt ttc aac tgc gga aac tgt aag ttt gga ttt ggg ggc cca aat tgt 397
Gly Phe Asn Cys Gly Asn Cys Lys Phe Gly Phe Gly Gly Pro Asn Cys
100 105 110
aca gag aag cga gtc ttg att aga aga aac att ttt gat ttg agt gtc 445
Thr Glu Lys Arg Val Leu Ile Arg Arg Asn Ile Phe Asp Leu Ser Val
115 120 125
tcc gaa aag aat aag ttc ttt tct tac ctc act tta gca aaa cat act 493
Ser Glu Lys Asn Lys Phe Phe Ser Tyr Leu Thr Leu Ala Lys His Thr
130 135 140
atc agc tca gtc tat gtc atc ccc aca ggc acc tat ggc caa atg aac 541
Ile Ser Ser Val Tyr Val Ile Pro Thr Gly Thr Tyr Gly Gln Met Asn
145 150 155 160
aat ggg tca aca ccc atg ttt aat gat atc aac atc tac gac ctc ttt 589
Asn Gly Ser Thr Pro Met Phe Asn Asp Ile Asn Ile Tyr Asp Leu Phe
165 170 175
gta tgg atg cat tac tat gtg tca agg gac aca ctg ctt ggg ggc tct 637
Val Trp Met His Tyr Tyr Val Ser Arg Asp Thr Leu Leu Gly Gly Ser
180 185 190
gaa ata tgg agg gac att gat ttt gcc cat gaa gca cca ggg ttt ctg 685
Glu Ile Trp Arg Asp Ile Asp Phe Ala His Glu Ala Pro Gly Phe Leu
195 200 205
cct tgg cac aga ctt ttc ttg tta ttg tgg gaa caa gaa att cga gaa 733
Pro Trp His Arg Leu Phe Leu Leu Leu Trp Glu Gln Glu Ile Arg Glu
210 215 220
cta act ggg gat gag aac ttc act gtt cca tac tgg gat tgg aga gat 781
Leu Thr Gly Asp Glu Asn Phe Thr Val Pro Tyr Trp Asp Trp Arg Asp
225 230 235 240
gca gaa aac tgt gac att tgc aca gat gag tac ttg gga ggt cgt cac 829
Ala Glu Asn Cys Asp Ile Cys Thr Asp Glu Tyr Leu Gly Gly Arg His
245 250 255
cct gaa aat cct aac tta ctc agc cca gca tcc ttc ttc tcc tcc tgg 877
Pro Glu Asn Pro Asn Leu Leu Ser Pro Ala Ser Phe Phe Ser Ser Trp
260 265 270
cag atc att tgt agc aga tca gaa gag tat aat agc cat cag gtt tta 925
Gln Ile Ile Cys Ser Arg Ser Glu Glu Tyr Asn Ser His Gln Val Leu
275 280 285
tgc gat gga aca cct gag gga cca cta tta cgt aat cct gga aac cat 973
Cys Asp Gly Thr Pro Glu Gly Pro Leu Leu Arg Asn Pro Gly Asn His
290 295 300
gac aaa gcc aaa acc ccc agg ctc cca tct tca gca gat gtg gaa ttt 1021
Asp Lys Ala Lys Thr Pro Arg Leu Pro Ser Ser Ala Asp Val Glu Phe
305 310 315 320
tgt ctg agt ttg acc cag tat gaa tct gga tca atg gat aga act gcc 1069
Cys Leu Ser Leu Thr Gln Tyr Glu Ser Gly Ser Met Asp Arg Thr Ala
325 330 335
aat ttc agc ttt aga aac aca ctg gaa gga ttt gcc agt cca ctc aca 1117
Asn Phe Ser Phe Arg Asn Thr Leu Glu Gly Phe Ala Ser Pro Leu Thr
340 345 350
ggg ata gca gat cct tct caa agt agc atg cac aat gcc tta cat atc 1165
Gly Ile Ala Asp Pro Ser Gln Ser Ser Met His Asn Ala Leu His Ile
355 360 365
ttt atg aat gga aca atg tcc caa gta cag gga tcg gcc aac gat ccc 1213
Phe Met Asn Gly Thr Met Ser Gln Val Gln Gly Ser Ala Asn Asp Pro
370 375 380
att ttt ctt ctt cac cat gct ttt gtg gac agt att ttt gaa caa tgg 1261
Ile Phe Leu Leu His His Ala Phe Val Asp Ser Ile Phe Glu Gln Trp
385 390 395 400
ctg cga agg cac cgc cct ctt ttg gaa gtt tac cca gaa gcc aat gca 1309
Leu Arg Arg His Arg Pro Leu Leu Glu Val Tyr Pro Glu Ala Asn Ala
405 410 415
cct atc ggc cat aac aga gac tct tac atg gtt cct ttc ata ccg ctc 1357
Pro Ile Gly His Asn Arg Asp Ser Tyr Met Val Pro Phe Ile Pro Leu
420 425 430
tat aga aat ggt gat ttc ttc ata aca tcc aag gat ctg gga tat gac 1405
Tyr Arg Asn Gly Asp Phe Phe Ile Thr Ser Lys Asp Leu Gly Tyr Asp
435 440 445
tac agc tac ctc caa gag tca gat cca ggc ttt tac aga aat tat att 1453
Tyr Ser Tyr Leu Gln Glu Ser Asp Pro Gly Phe Tyr Arg Asn Tyr Ile
450 455 460
gag cct tac ttg gaa caa gcc agt cgt atc tgg cca tgg ctt ctt ggg 1501
Glu Pro Tyr Leu Glu Gln Ala Ser Arg Ile Trp Pro Trp Leu Leu Gly
465 470 475 480
gca gca ctg gtg gga gct gtt att gct gca gct ctc tct ggg ctt agc 1549
Ala Ala Leu Val Gly Ala Val Ile Ala Ala Ala Leu Ser Gly Leu Ser
485 490 495
agt agg cta tgc ctt cag aag aag aag aag aag aag caa ccc cag gag 1597
Ser Arg Leu Cys Leu Gln Lys Lys Lys Lys Lys Lys Gln Pro Gln Glu
500 505 510
gaa agg cag cca ctc ctc atg gac aaa gac gac tac cac agc ttg ctg 1645
Glu Arg Gln Pro Leu Leu Met Asp Lys Asp Asp Tyr His Ser Leu Leu
515 520 525
tat cag agc cat ctg tga acatcctagg aaacagagtg ggactgaaag 1693
Tyr Gln Ser His Leu *
530
gttttacctc actcgaccta tttgttggtg tttctacaaa tttaaactag tataaaacat 1753
agaccatagc tgtttggctt tttttcagac ccatgttttt tcctaagtcc tagtttctaa 1813
gaaatgactg ggatttgcta aaatatatat atatataaat aataacttac taatagctaa 1873
ataaaatttc ctcttacaac taattgagct ggtttttatg aatgtgtctt aattatttaa 1933
acttgaggca catttttgtt ttccttactt cattgtgaat ttccaagaaa aatattctct 1993
ctctctctct ctctcgtgtg tttgtgtgta tgtgtgtgtt aactgattca aacaattttg 2053
aaaatcttgg attgatagaa atgattcatt aatttatgaa attatttcat taatgattag 2113
gaaagacgaa taattactaa attagtaaca gaggagaaca tctgccagct tttaattaaa 2173
ttgtcattta agttacctta tctaccttct gtgactggtg gaaaaatatc aggcaagaga 2233
tgggaatgct ctgcctaata ggatagtggc tcctggaagg agtgggttat tactagagat 2293
tattacctga agtttaccat agttagaaaa ttaatcaaaa cagatgactc agtaacatct 2353
gaagcttcaa gtcggcttga ctgcaatctg aaatcatcaa gcccaagagc caaaggaatg 2413
ggaacagcga tgggaaacta tctgaatcag attctagtgt gatagtgtca ggggcacatg 2473
ggtcatcttt gagaccttca cacctgttga gtcaccaaaa tttgctgtga atgtaaattt 2533
ttactgtaaa ttaatttttt cttttctttt taaaaagatt tatttattat tatacataag 2593
tacactgtag ctgtcttcag acacaccaga agagggtgtc agatctcatt acagatggtt 2653
gtgagccacc atgtggttgc tgggatttga actcaggacc tctggaagaa cagtcagtgc 2713
tcttacccgc tgagccatct cgccagtccc agtaaatttt tactttagtg aaagtaaaat 2773
ttaagtttta gtttttagtt tagtaaaatt ttaggaagca aatttttagt tttctaaact 2833
aatttttttt tctagtactg gacatcaacc cagtgccttg tatatgcaat gcaagcattt 2893
tcttgtactc tgctacctag catgtatata taaatctacc caacaaatgt tcattacagc 2953
tgacaagggt ctttataaac tcagtgtttc cctttatcac aatacaattc cctcctttgc 3013
cacttcatgt catcatagaa tattgttttt ttctctagcg gttcaaggta tgtatttgta 3073
tagcagtcac acctttgata aaagttacca tctctttgat tatatatctc attatggtaa 3133
caaaattata ttatgactat ttcaatatat ctgaaagttt cattaaattc tcattaactt 3193
tgtatatttc agtcttgctt attgtgaagc ttttataaat tgcttcactt tttttctgaa 3253
attgtcctgt tgctacatca ttctgttaag aaataaataa gtggcaatat tttcc 3308
<210> SEQ ID NO 12
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: PCR Primer
<400> SEQUENCE: 12
tcgagcctgt gcctcctcta 20
<210> SEQ ID NO 13
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: PCR Primer
<400> SEQUENCE: 13
gactcccatc acccatccat 20
<210> SEQ ID NO 14
<211> LENGTH: 25
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: PCR Probe
<400> SEQUENCE: 14
ttgttggcaa aagaatgctg cccac 25
<210> SEQ ID NO 15
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: PCR Primer
<400> SEQUENCE: 15
ggcaaattca acggcacagt 20
<210> SEQ ID NO 16
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: PCR Primer
<400> SEQUENCE: 16
gggtctcgct cctggaagat 20
<210> SEQ ID NO 17
<211> LENGTH: 27
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: PCR Probe
<400> SEQUENCE: 17
aaggccgaga atgggaagct tgtcatc 27
<210> SEQ ID NO 18
<220> FEATURE:
<400> SEQUENCE: 18
000
<210> SEQ ID NO 19
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 19
cctctgcctg aaagctggcc 20
<210> SEQ ID NO 20
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 20
tggcaggtcc tattataaaa 20
<210> SEQ ID NO 21
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 21
tcatgggcaa aatcaatgtc 20
<210> SEQ ID NO 22
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 22
ctggtgcttc atgggcaaaa 20
<210> SEQ ID NO 23
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 23
tcatctgtgc aaatgtcaca 20
<210> SEQ ID NO 24
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 24
ggctgagtaa gttaggattt 20
<210> SEQ ID NO 25
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 25
tcatggtttc caggattacg 20
<210> SEQ ID NO 26
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 26
tctaaagctg aaattggcag 20
<210> SEQ ID NO 27
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 27
gggacattgt tccattcata 20
<210> SEQ ID NO 28
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 28
ctctattgcc taagcctttt 20
<210> SEQ ID NO 29
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 29
ttgcaaatga gaggtagtgt 20
<210> SEQ ID NO 30
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 30
gacctaagca aacccagtta 20
<210> SEQ ID NO 31
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 31
attcttatgg ttagaatatt 20
<210> SEQ ID NO 32
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 32
ctggctaatt ggagtcacag 20
<210> SEQ ID NO 33
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 33
tggccctact ctattgccta 20
<210> SEQ ID NO 34
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 34
ttagagtgag gtcaggcttt 20
<210> SEQ ID NO 35
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 35
ggaaaatgtt aaaagggctg 20
<210> SEQ ID NO 36
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 36
gttcctcatt accaaatagc 20
<210> SEQ ID NO 37
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 37
gagaccataa agaggctaca 20
<210> SEQ ID NO 38
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 38
tgtcaggaat agagcttctc 20
<210> SEQ ID NO 39
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 39
ctctgaaaag cacatgactg 20
<210> SEQ ID NO 40
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 40
cacatgtctt ggctgagacc 20
<210> SEQ ID NO 41
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 41
gagcactggc aggtcctatt 20
<210> SEQ ID NO 42
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 42
gatgctgggc tgagtaagtt 20
<210> SEQ ID NO 43
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 43
gccttttata aatggctctg 20
<210> SEQ ID NO 44
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 44
gttggaagaa ggctacactt 20
<210> SEQ ID NO 45
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 45
ctacctgagt tggaagaagg 20
<210> SEQ ID NO 46
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 46
ctgagtgaaa acagcaagac 20
<210> SEQ ID NO 47
<211> LENGTH: 480
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 47
agttctgaag aaaaattttt gacaaaatga gttctataaa tgttattgtc tacttatgat 60
ctctaaatac aacaggcttg tattcagaat ctagatgttt catgaccttt attcataaga 120
gatgatgtat tcttgatact acttctcatt tgcaaattcc aattattatt aatttcatat 180
caattagaat aatatatctt ccttcaattt agttacctca ctatgggcta tgtacaaact 240
ccaagaaaaa gttagtcatg tgctttgcag aagataaaag cttagtgtaa aacaggctga 300
gagtatttga tgtaagaagg ggagtggtta tataggtctt agccaaaaca tgtgatagtc 360
actccagggg ttgctggaaa agaagtctgt gacactcatt aacctattgg tgcagatttt 420
gtatgatcta aaggagaaa atg ttc ttg gct gtt ttg tat tgc ctt ctg tgg 472
agtttcca 480
<210> SEQ ID NO 48
<211> LENGTH: 1838
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<220> FEATURE:
<221> NAME/KEY: CDS
<222> LOCATION: (65)...(1411)
<400> SEQUENCE: 48
ggaaaagaag tctgtgacac tcattaacct attggtgcag attttgtatg atctaaagga 60
gaaa atg ttc ttg gct gtt ttg tat tgc ctt ctg tgg agt ttc cag atc 109
Met Phe Leu Ala Val Leu Tyr Cys Leu Leu Trp Ser Phe Gln Ile
1 5 10 15
tct gat ggc cat ttt cct cga gcc tgt gcc tcc tct aag aac ttg ttg 157
Ser Asp Gly His Phe Pro Arg Ala Cys Ala Ser Ser Lys Asn Leu Leu
20 25 30
gca aaa gaa tgc tgc cca cca tgg atg ggt gat ggg agt ccc tgc ggc 205
Ala Lys Glu Cys Cys Pro Pro Trp Met Gly Asp Gly Ser Pro Cys Gly
35 40 45
cag ctt tca ggc aga ggt tcc tgc cag gat atc ctt ctg tcc agt gca 253
Gln Leu Ser Gly Arg Gly Ser Cys Gln Asp Ile Leu Leu Ser Ser Ala
50 55 60
cca tct gga cct cag ttc ccc ttc aaa ggg gtg gat gac cgt gag tcc 301
Pro Ser Gly Pro Gln Phe Pro Phe Lys Gly Val Asp Asp Arg Glu Ser
65 70 75
tgg ccc tct gtg ttt tat aat agg acc tgc cag tgc tca ggc aac ttc 349
Trp Pro Ser Val Phe Tyr Asn Arg Thr Cys Gln Cys Ser Gly Asn Phe
80 85 90 95
atg ggt ttc aac tgc gga aac tgt aag ttt gga ttt ggg ggc cca aat 397
Met Gly Phe Asn Cys Gly Asn Cys Lys Phe Gly Phe Gly Gly Pro Asn
100 105 110
tgt aca gag aag cga gtc ttg att aga aga aac att ttt gat ttg agt 445
Cys Thr Glu Lys Arg Val Leu Ile Arg Arg Asn Ile Phe Asp Leu Ser
115 120 125
gtc tcc gaa aag aat aag ttc ttt tct tac ctc act tta gca aaa cat 493
Val Ser Glu Lys Asn Lys Phe Phe Ser Tyr Leu Thr Leu Ala Lys His
130 135 140
act atc agc tca gtc tat gtc atc ccc aca ggc acc tat ggc caa atg 541
Thr Ile Ser Ser Val Tyr Val Ile Pro Thr Gly Thr Tyr Gly Gln Met
145 150 155
aac aat ggg tca aca ccc atg ttt aat gat atc aac atc tac gac ctc 589
Asn Asn Gly Ser Thr Pro Met Phe Asn Asp Ile Asn Ile Tyr Asp Leu
160 165 170 175
ttt gta tgg atg cat tac tat gtg tca agg gac aca ctg ctt ggg ggc 637
Phe Val Trp Met His Tyr Tyr Val Ser Arg Asp Thr Leu Leu Gly Gly
180 185 190
tct gaa ata tgg agg gac att gat ttt gcc cat gaa gca cca ggg ttt 685
Ser Glu Ile Trp Arg Asp Ile Asp Phe Ala His Glu Ala Pro Gly Phe
195 200 205
ctg cct tgg cac aga ctt ttc ttg tta ttg tgg gaa caa gaa att cga 733
Leu Pro Trp His Arg Leu Phe Leu Leu Leu Trp Glu Gln Glu Ile Arg
210 215 220
gaa cta act ggg gat gag aac ttc act gtt cca tac tgg gat tgg aga 781
Glu Leu Thr Gly Asp Glu Asn Phe Thr Val Pro Tyr Trp Asp Trp Arg
225 230 235
gat gca gaa aac tgt gac att tgc aca gat gag tac ttg gga ggt cgt 829
Asp Ala Glu Asn Cys Asp Ile Cys Thr Asp Glu Tyr Leu Gly Gly Arg
240 245 250 255
cac cct gaa aat cct aac tta ctc agc cca gca tcc ttc ttc tcc tcc 877
His Pro Glu Asn Pro Asn Leu Leu Ser Pro Ala Ser Phe Phe Ser Ser
260 265 270
tgg cag atc att tgt agc aga tca gaa gag tat aat agc cat cag gtt 925
Trp Gln Ile Ile Cys Ser Arg Ser Glu Glu Tyr Asn Ser His Gln Val
275 280 285
tta tgc gat gga aca cct gag gga cca cta tta cgt aat cct gga aac 973
Leu Cys Asp Gly Thr Pro Glu Gly Pro Leu Leu Arg Asn Pro Gly Asn
290 295 300
cat gac aaa gcc aaa acc ccc agg ctc cca tct tca gca gat gtg gaa 1021
His Asp Lys Ala Lys Thr Pro Arg Leu Pro Ser Ser Ala Asp Val Glu
305 310 315
ttt tgt ctg agt ttg acc cag tat gaa tct gga tca atg gat aga act 1069
Phe Cys Leu Ser Leu Thr Gln Tyr Glu Ser Gly Ser Met Asp Arg Thr
320 325 330 335
gcc aat ttc agc ttt aga aac aca ctg gaa gta ttt ttg ttt gaa cac 1117
Ala Asn Phe Ser Phe Arg Asn Thr Leu Glu Val Phe Leu Phe Glu His
340 345 350
aat ggc tgc gaa ggg cac cgc cct ctt ttg gaa gtt tac cca gaa gcc 1165
Asn Gly Cys Glu Gly His Arg Pro Leu Leu Glu Val Tyr Pro Glu Ala
355 360 365
aat gca cct atc ggc cat aac aga gac tct tac atg gtt cct ttc ata 1213
Asn Ala Pro Ile Gly His Asn Arg Asp Ser Tyr Met Val Pro Phe Ile
370 375 380
ccg ctc tat aga aat ggt gat ttc ttc ata aca tcc aag gat ctg gga 1261
Pro Leu Tyr Arg Asn Gly Asp Phe Phe Ile Thr Ser Lys Asp Leu Gly
385 390 395
tat gac tac agc tac ctc caa gag tca gat cca ggc ttt tac aga aat 1309
Tyr Asp Tyr Ser Tyr Leu Gln Glu Ser Asp Pro Gly Phe Tyr Arg Asn
400 405 410 415
tat att gag cct tac ttg gaa caa ggc cag tcg tat ctg gcc atg gct 1357
Tyr Ile Glu Pro Tyr Leu Glu Gln Gly Gln Ser Tyr Leu Ala Met Ala
420 425 430
tct tgg ggc agc act ggt ggg agc tgt tat tgc tgc agc tct ctc tgg 1405
Ser Trp Gly Ser Thr Gly Gly Ser Cys Tyr Cys Cys Ser Ser Leu Trp
435 440 445
gct tag cagtaggcta tgccttcaga agaagaagaa gaagaagcaa ccccaggagg 1461
Ala
aaaggcagcc actcctcatg gacaaagacg actaccacag cttgctgtat cagagccatc 1521
tgtgaacatc ctaggaaaca gagtggactg aaaggtttta cctcactcga cctatttgtt 1581
ggtgtttcta caaatttaaa ctagcataaa acatagacca tagctgtttg gctttttttc 1641
agacccatgt tttttcctaa gtcctagttt ctaagaaatg actgggattt gctaaaatat 1701
atatatatat aaataataac ttactaatag ctaaataaaa tttcctctta caactaattg 1761
agtggttttt atgaatgtgt cttaattatt taaacttgag gcacattttt gttttcctta 1821
cttcattgtg aatttcc 1838
<210> SEQ ID NO 49
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 49
gaacatttct cctttagatc 20
<210> SEQ ID NO 50
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 50
agccaagaac atttctcctt 20
<210> SEQ ID NO 51
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 51
ggccatcaga gatctggaaa 20
<210> SEQ ID NO 52
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 52
ctcgaggaaa atggccatca 20
<210> SEQ ID NO 53
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 53
ttgccaacaa gttcttagag 20
<210> SEQ ID NO 54
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 54
aggaacctct gcctgaaagc 20
<210> SEQ ID NO 55
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 55
acagagggcc aggactcacg 20
<210> SEQ ID NO 56
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 56
agcactggca ggtcctatta 20
<210> SEQ ID NO 57
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 57
ttccgcagtt gaaacccatg 20
<210> SEQ ID NO 58
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 58
gggcccccaa atccaaactt 20
<210> SEQ ID NO 59
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 59
acaatttggg cccccaaatc 20
<210> SEQ ID NO 60
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 60
agtatgtttt gctaaagtga 20
<210> SEQ ID NO 61
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 61
gagctgatag tatgttttgc 20
<210> SEQ ID NO 62
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 62
ggatgacata gactgagctg 20
<210> SEQ ID NO 63
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 63
atttggccat aggtgcctgt 20
<210> SEQ ID NO 64
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 64
ggtgttgacc cattgttcat 20
<210> SEQ ID NO 65
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 65
tgtgtccctt gacacatagt 20
<210> SEQ ID NO 66
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 66
gtgcttcatg ggcaaaatca 20
<210> SEQ ID NO 67
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 67
aagaaaagtc tgtgccaagg 20
<210> SEQ ID NO 68
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 68
ttctcatccc cagttagttc 20
<210> SEQ ID NO 69
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 69
tgctgggctg agtaagttag 20
<210> SEQ ID NO 70
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 70
gatctgctac aaatgatctg 20
<210> SEQ ID NO 71
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 71
atggctatta tactcttctg 20
<210> SEQ ID NO 72
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 72
atccagattc atactgggtc 20
<210> SEQ ID NO 73
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 73
ttgtgcatgc tactttgaga 20
<210> SEQ ID NO 74
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 74
aaggcattgt gcatgctact 20
<210> SEQ ID NO 75
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 75
cattcataaa gatatgtaag 20
<210> SEQ ID NO 76
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 76
gtccacaaaa gcatggtgaa 20
<210> SEQ ID NO 77
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 77
gataggtgca ttggcttctg 20
<210> SEQ ID NO 78
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 78
tgaaaggaac catgtaagag 20
<210> SEQ ID NO 79
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 79
gatccttgga tgttatgaag 20
<210> SEQ ID NO 80
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 80
tagctgtagt catatcccag 20
<210> SEQ ID NO 81
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 81
tataatttct gtaaaagcct 20
<210> SEQ ID NO 82
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 82
gccccaagaa gccatggcca 20
<210> SEQ ID NO 83
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 83
gcccagagag agctgcagca 20
<210> SEQ ID NO 84
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 84
agctgtggta gtcgtctttg 20
<210> SEQ ID NO 85
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 85
taggatgttc acagatggct 20
<210> SEQ ID NO 86
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 86
tcccactctg tttcctagga 20
<210> SEQ ID NO 87
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 87
atatatttta gcaaatccca 20
<210> SEQ ID NO 88
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 88
aggaaatttt atttagctat 20
<210> SEQ ID NO 89
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 89
aaaaccagct caattagttg 20
<210> SEQ ID NO 90
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 90
gcctcaagtt taaataatta 20
<210> SEQ ID NO 91
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 91
aatgtgcctc aagtttaaat 20
<210> SEQ ID NO 92
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 92
tcttggaaat tcacaatgaa 20
<210> SEQ ID NO 93
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 93
caagattttc aaaattgttt 20
<210> SEQ ID NO 94
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 94
ctttcctaat cattaatgaa 20
<210> SEQ ID NO 95
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 95
cctgatattt ttccaccagt 20
<210> SEQ ID NO 96
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 96
tttcagattg cagtcaagcc 20
<210> SEQ ID NO 97
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 97
gctgttccca ttcctttggc 20
<210> SEQ ID NO 98
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 98
cctgacacta tcacactaga 20
<210> SEQ ID NO 99
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 99
caacaggtgt gaaggtctca 20
<210> SEQ ID NO 100
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 100
gtgactcaac aggtgtgaag 20
<210> SEQ ID NO 101
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 101
cagtaaaaat ttacattcac 20
<210> SEQ ID NO 102
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 102
gcttcctaaa attttactaa 20
<210> SEQ ID NO 103
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 103
aaactaaaaa tttgcttcct 20
<210> SEQ ID NO 104
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 104
cttgcattgc atatacaagg 20
<210> SEQ ID NO 105
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 105
agaaaatgct tgcattgcat 20
<210> SEQ ID NO 106
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 106
atatatacat gctaggtagc 20
<210> SEQ ID NO 107
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 107
ataaagaccc ttgtcagctg 20
<210> SEQ ID NO 108
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 108
atacatacct tgaaccgcta 20
<210> SEQ ID NO 109
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 109
tatacaaata cataccttga 20
<210> SEQ ID NO 110
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 110
ttaccataat gagatatata 20
<210> SEQ ID NO 111
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 111
cagatatatt gaaatagtca 20
<210> SEQ ID NO 112
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 112
tgagaattta atgaaacttt 20
<210> SEQ ID NO 113
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 113
tttcttaaca gaatgatgta 20
<210> SEQ ID NO 114
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 114
catttataga actcattttg 20
<210> SEQ ID NO 115
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 115
cttatgaata aaggtcatga 20
<210> SEQ ID NO 116
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 116
tttatcttct gcaaagcaca 20
<210> SEQ ID NO 117
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Antisense Oligonucleotide
<400> SEQUENCE: 117
gttcaaacaa aaatacttcc 20
<210> SEQ ID NO 118
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 118
ggccagcuuu caggcagagg 20
<210> SEQ ID NO 119
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 119
uuuuauaaua ggaccugcca 20
<210> SEQ ID NO 120
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 120
gacauugauu uugcccauga 20
<210> SEQ ID NO 121
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 121
uuuugcccau gaagcaccag 20
<210> SEQ ID NO 122
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 122
ugugacauuu gcacagauga 20
<210> SEQ ID NO 123
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 123
aaauccuaac uuacucagcc 20
<210> SEQ ID NO 124
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 124
cguaauccug gaaaccauga 20
<210> SEQ ID NO 125
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 125
cugccaauuu cagcuuuaga 20
<210> SEQ ID NO 126
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 126
uaugaaugga acaauguccc 20
<210> SEQ ID NO 127
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 127
cugugacucc aauuagccag 20
<210> SEQ ID NO 128
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 128
uaggcaauag aguagggcca 20
<210> SEQ ID NO 129
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 129
aaagccugac cucacucuaa 20
<210> SEQ ID NO 130
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 130
cagcccuuuu aacauuuucc 20
<210> SEQ ID NO 131
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 131
gcuauuuggu aaugaggaac 20
<210> SEQ ID NO 132
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 132
aauaggaccu gccagugcuc 20
<210> SEQ ID NO 133
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 133
aacuuacuca gcccagcauc 20
<210> SEQ ID NO 134
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 134
cagagccauu uauaaaaggc 20
<210> SEQ ID NO 135
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 135
aaguguagcc uucuuccaac 20
<210> SEQ ID NO 136
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 136
ccuucuucca acucagguag 20
<210> SEQ ID NO 137
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: H. sapiens
<220> FEATURE:
<400> SEQUENCE: 137
gucuugcugu uuucacucag 20
<210> SEQ ID NO 138
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 138
aaggagaaau guucuuggcu 20
<210> SEQ ID NO 139
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 139
uuuccagauc ucugauggcc 20
<210> SEQ ID NO 140
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 140
ugauggccau uuuccucgag 20
<210> SEQ ID NO 141
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 141
cucuaagaac uuguuggcaa 20
<210> SEQ ID NO 142
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 142
gcuuucaggc agagguuccu 20
<210> SEQ ID NO 143
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 143
cgugaguccu ggcccucugu 20
<210> SEQ ID NO 144
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 144
uaauaggacc ugccagugcu 20
<210> SEQ ID NO 145
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 145
cauggguuuc aacugcggaa 20
<210> SEQ ID NO 146
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 146
aaguuuggau uugggggccc 20
<210> SEQ ID NO 147
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 147
gauuuggggg cccaaauugu 20
<210> SEQ ID NO 148
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 148
ucacuuuagc aaaacauacu 20
<210> SEQ ID NO 149
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 149
gcaaaacaua cuaucagcuc 20
<210> SEQ ID NO 150
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 150
cagcucaguc uaugucaucc 20
<210> SEQ ID NO 151
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 151
acaggcaccu auggccaaau 20
<210> SEQ ID NO 152
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 152
ugauuuugcc caugaagcac 20
<210> SEQ ID NO 153
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 153
cuaacuuacu cagcccagca 20
<210> SEQ ID NO 154
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 154
cagaucauuu guagcagauc 20
<210> SEQ ID NO 155
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 155
cagaagagua uaauagccau 20
<210> SEQ ID NO 156
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 156
gacccaguau gaaucuggau 20
<210> SEQ ID NO 157
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 157
ucucaaagua gcaugcacaa 20
<210> SEQ ID NO 158
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 158
aguagcaugc acaaugccuu 20
<210> SEQ ID NO 159
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 159
uucaccaugc uuuuguggac 20
<210> SEQ ID NO 160
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 160
cagaagccaa ugcaccuauc 20
<210> SEQ ID NO 161
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 161
cugggauaug acuacagcua 20
<210> SEQ ID NO 162
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 162
aggcuuuuac agaaauuaua 20
<210> SEQ ID NO 163
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 163
uggccauggc uucuuggggc 20
<210> SEQ ID NO 164
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 164
ugcugcagcu cucucugggc 20
<210> SEQ ID NO 165
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 165
caaagacgac uaccacagcu 20
<210> SEQ ID NO 166
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 166
agccaucugu gaacauccua 20
<210> SEQ ID NO 167
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 167
uccuaggaaa cagaguggga 20
<210> SEQ ID NO 168
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 168
ugggauuugc uaaaauauau 20
<210> SEQ ID NO 169
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 169
auagcuaaau aaaauuuccu 20
<210> SEQ ID NO 170
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 170
uucauuguga auuuccaaga 20
<210> SEQ ID NO 171
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 171
uucauuaaug auuaggaaag 20
<210> SEQ ID NO 172
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 172
acugguggaa aaauaucagg 20
<210> SEQ ID NO 173
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 173
ggcuugacug caaucugaaa 20
<210> SEQ ID NO 174
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 174
gccaaaggaa ugggaacagc 20
<210> SEQ ID NO 175
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 175
ugagaccuuc acaccuguug 20
<210> SEQ ID NO 176
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 176
cuucacaccu guugagucac 20
<210> SEQ ID NO 177
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 177
uuaguaaaau uuuaggaagc 20
<210> SEQ ID NO 178
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 178
ccuuguauau gcaaugcaag 20
<210> SEQ ID NO 179
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 179
augcaaugca agcauuuucu 20
<210> SEQ ID NO 180
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 180
gcuaccuagc auguauauau 20
<210> SEQ ID NO 181
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 181
cagcugacaa gggucuuuau 20
<210> SEQ ID NO 182
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 182
uagcgguuca agguauguau 20
<210> SEQ ID NO 183
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 183
ugacuauuuc aauauaucug 20
<210> SEQ ID NO 184
<211> LENGTH: 20
<212> TYPE: DNA
<213> ORGANISM: M. musculus
<220> FEATURE:
<400> SEQUENCE: 184
uacaucauuc uguuaagaaa 20
You are contracting for Modulation of tyrosinase expression
Expert Modulation of tyrosinase expression
You are commenting for Modulation of tyrosinase expression